Tapasin(TAPBP) (NM_003190) Human Untagged Clone

CAT#: SC111697

TAPBP (untagged)-Human TAP binding protein (tapasin) (TAPBP), transcript variant 1

USD 711


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Tapasin(TAPBP) (NM_003190) Human Untagged Clone
Symbol TAPBP
Synonyms NGS17; TAPA; TPN; TPSN
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_003190, the custom clone sequence may differ by one or more nucleotides


ATGAAGTCCCTGTCTCTGCTCCTCGCTGTGGCTTTGGGCCTGGCGACCGCCGTCTCAGCAGGACCCGCGG
TGATCGAGTGTTGGTTCGTGGAGGATGCGAGCGGAAAGGGCCTGGCCAAGAGACCCGGTGCACTGCTGTT
GCGCCAGGGACCGGGGGAACCGCCGCCCCGGCCGGACCTCGACCCTGAGCTCTATCTCAGTGTACACGAC
CCCGCGGGCGCCCTCCAGGCTGCCTTCAGGCGGTATCCCCGGGGCGCCCCCGCACCACACTGCGAGATGA
GCCGCTTCGTGCCTCTCCCCGCCTCTGCGAAATGGGCCAGCGGCCTGACCCCCGCGCAGAACTGCCCGCG
GGCCCTGGATGGGGCTTGGCTGATGGTCAGCATATCCAGCCCAGTCCTCAGCCTCTCCAGCCTCTTGCGA
CCACAGCCAGAGCCTCAGCAGGAGCCTGTTCTCATCACCATGGCAACAGTGGTACTGACTGTCCTCACCC
ACACCCCTGCCCCTCGAGTGAGACTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCCTACATGCCCCC
CACCTCCGAGGCCGCCTCATCTCTGGCTCCGGGTCCCCCTCCCTTTGGGCTAGAGTGGCGACGCCAGCAC
CTGGGTAAGGGACATCTGCTCCTGGCTGCAACTCCTGGGCTGAATGGCCAGATGCCAGCAGCCCAAGAAG
GGGCCGTGGCATTTGCTGCTTGGGATGATGATGAGCCATGGGGCCCATGGACCGGAAATGGGACCTTCTG
GCTGCCTACAGTTCAACCCTTTCAGGAGGGCACCTATCTGGCCACCATACACCTGCCATACCTGCAAGGA
CAGGTCACCCTGGAGCTTGCTGTGTACAAACCCCCCAAAGTGTCCCTGATGCCAGCAACCCTTGCACGGG
CCGCCCCAGGGGAGGCACCCCCGGAATTGCTCTGCCTTGTGTCCCACTTCTACCCTTCTGGGGGCCTGGA
GGTGGAGTGGGAACTCCGGGGTGGCCCAGGGGGCCGCTCTCAGAAGGCCGAGGGGCAGAGGTGGCTCTCG
GCCCTGCGCCACCATTCCGATGGCTCTGTCAGCCTCTCTGGGCACTTGCAGCCGCCCCCAGTCACCACTG
AGCAGCATGGGGCACGCTATGCCTGTCGAATTCACCATCCCAGCCTGCCTGCCTCGGGGCGCAGCGCTGA
GGTCACCCTGGAGGTAGCAGGTCTTTCAGGGCCCTCCCTTGAGGACAGCGTAGGCCTTTTCCTGTCTGCC
TTTCTTCTGCTTGGGCTCTTCAAGGCACTGGGCTGGGCTGCTGTCTACCTGTCCACCTGCAAGGATTCAA
AGAAGAAAGCAGAGTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_003190 unedited
ATCCCCCGCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA
GAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAA
TTCGGCACCAGGCAGCGCCATGAAGTCCCTGTCTCTGCTCCTCGCTGTGGCTTTGGGCCT
GGCGACCGCCGTCTCAGCAGGACCCGCGGTGATCGAGTGTTGGTTCGTGGAGGATGCGAG
CGGAAAGGGCCTGGCCAAGAGACCCGGTGCACTGCTGTTGCGCCAGGGACCGGGGGAACC
GCCGCCCCGGCCGGACCTCGACCCTGAGCTCTATCTCAGTGTACACGACCCCGCGGGCGC
CCTCCAGGCTGCCTTCAGGCGGTATCCCCGGGGCGCCCCCGCACCACACTGCGAGATGAG
CCGCTTCGTGCCTCTCCCCGCCTCTGCGAAATGGGCCAGCGGCCTGACCCCCGCGCAGAA
CTGCCCGCGGGCCCTGGATGGGGCTTGGCTGATGGTCAGCATATCCAGCCCAGTCCTCAG
CCTCTCCAGCCTCTTGCGACCACAGCCAGAGCCTCAGCAGGAGCCTGTTCTCATCACCAT
GGCAACAGTGGTACTGACTGTCCTCACCCACACCCCTGCCCCTCGAGTGAGACTGGGACA
AGATGCTCTGCTGGACTTGAGCTTTGCCTACATGCCCCCCACCTCCGAAGCCGCCTCATC
TCTGGCTCCGGGTCCCCCCTCCTTTGGGCTAGAGTGGCGACGCCAGCACCTGGGTAAGGG
ACATCTGCTCCTGGNCTGCACTCCTGGGCTGAATGGCCAGATGCCAGCAGCCCAAGAGGG
GCCGTGGGCATTGCTGCTTGGGATGATGATGAGCCATGGGGCCCATGGGACCGGGAATGG
GACCNTCTGGCTGNCTAGAGTTCAACCCTTTCAGGAGGGNCACTATCTGCCACCATACAC
C
3' Read Nucleotide Sequence
>OriGene 3' read for NM_003190 unedited
TAAAAGCGCTACTATGTACGCGGCCGCTTTTTANNGTCGAGTTTTTTTTTTTTTTTTTTT
TTAGGAGCAGATGATAGGGTATTATTTTAGGGAGCTACTACAGAAGCTTGGGCCAGAGAT
GATGGTGGCTTCCACAGGATGGCAGTGAGTGCCCTCACTCTGCTTTCTTCTTTGAATCCT
TGCAGGTGGACAGGTAGACAGCAGCCCAGCCCAGTGCCTTGAAGAGCCCAAGCAGAAGAA
AGGCAGACAGGAAAAGGCCTACGCTGTCCTCAAGGGAGGGCCCTGAAAGACCTGCTACCT
CCAGGGTGACCTCAGCGCTGCGCCCCGAGGCAGGCAGGCTGGGATGGTGAATTCGACAGG
CATAGCGTGCCCCATGCTGCTCAGTGGTGACTGGGGGCGGCTGCAAGTGCCCAGAGAGGC
TGACAGAGCCATCGGAATGGTGGCGCAGGGCCGAGAGCCACCTCTGCCCCTCGGCCTTCT
GAGAGCGGCCCCCTGGGCCACCCCGGAGTTCCCACTCCACCTCCAGGCCCCCAGAATGGT
AGAAGTGGGACACAAAGCAGAGCAATTCCGGGGGTGCCTCCCCTGGGGCGGCCCGTGCAA
GGGTTGCTGGCATCAAGGACACTTTGGGGGGTTTGTACACAGCAAGCTCCAGGTGACCTG
TCCTTGCAGTTTGGCAGGTGTTTGGTGGCCANATAGGTGCCCTCCTGAAGGGTTGAAACT
CTAGGCAGCCAGAAAAGTCCCATTTTCGGGGCATTGGGCCCCATGGCTCATCTTTCTCCC
AAGCAGGCAAATGCCCCGGGCCCCTTTCTTGGGCTGCTGGGCATTTGGGCCTTTCAAGCC
CAGGAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_003190
ORF Size 1347 bp
Insert Size 1500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003190.3, NP_003181
RefSeq Size 3629
RefSeq ORF 1347
Locus ID 6892
Cytogenetics 6p21.32
Protein Families Transmembrane, Druggable Genome
Protein Pathways Antigen processing and presentation
Gene Summary This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.