BMP4(BMP4) (NM_130851) Human Untagged Clone

CAT#: SC110838

BMP4 (untagged)-Human bone morphogenetic protein 4 (BMP4), transcript variant 3

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name BMP4(BMP4) (NM_130851) Human Untagged Clone
Symbol BMP4
Synonyms BMP2B; BMP2B1; MCOPS6; OFC11; ZYME
Vector pCMV6-XL6
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_130851 edited
GAATTCGGCACGAGGACGCACTGCTGCAGCTTCCCTGAGCCTTTCCAGCAAGTTTGTTCA
AGATTGGCTGTCAAGAATCATGGACTGTTATTATATGCCTTGTTTTCTGTCAAGACACCA
TGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGCG
CGAGCCATGCTAGTTTGATACCTGAGACGGGGAAGAAAAAAGTCGCCGAGATTCAGGGCC
ACGCGGGAGGACGCCGCTCAGGGCAGAGCCATGAGCTCCTGCGGGACTTCGAGGCGACAC
TTCTGCAGATGTTTGGGCTGCGCCGCCGCCCGCAGCCTAGCAAGAGTGCCGTCATTCCGG
ACTACATGCGGGATCTTTACCGGCTTCAGTCTGGGGAGGAGGAGGAAGAGCAGATCCACA
GCACTGGTCTTGAGTATCCTGAGCGCCCGGCCAGCCGGGCCAACACCGTGAGGAGCTTCC
ACCACGAAGAACATCTGGAGAACATCCCAGGGACCAGTGAAAACTCTGCTTTTCGTTTCC
TCTTTAACCTCAGCAGCATCCCTGAGAACGAGGTGATCTCCTCTGCAGAGCTTCGGCTCT
TCCGGGAGCAGGTGGACCAGGGCCCTGATTGGGAAAGGGGCTTCCACCGTATAAACATTT
ATGAGGTTATGAAGCCCCCAGCAGAAGTGGTGCCTGGGCACCTCATCACACGACTACTGG
ACACGAGACTGGTCCACCACAATGTGACACGGTGGGAAACTTTTGATGTGAGCCCTGCGG
TCCTTCGCTGGACCCGGGAGAAGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACC
TCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAG
GGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGG
GCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGG
CCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGG
GCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACT
GCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGG
TCAATTCTGTCAATTCCAGTATCCCCAAAGCCTGTTGTGTGCCCACTGAACTGAGTGCCA
TCTCCATGCTGTACCTGGATGAGTATGATAAGGTGGTACTGAAAAATTATCAGGAGATGG
TAGTAGAGGGATGTGGGTGCCGCTGAGATCAGGCAGTCCTTGAGGATAGACAGATATACA
CACCACACACACACACCACATACACCACACACACACGTTCCCATCCACTCACCCACACAC
TACACAGACTGCTTCCTTATAGCTGGACTTTTATTTAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_130851 unedited
CCATTCCCCCGCCCGTTGCCGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAA
GCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCG
CGAATTCGGCACGAGGACGCACTGCTGCAGCTTCCCTGAGCCTTTCCAGCACGTTTGTTC
AAGATTGGCTGTCAAGAATCATGGACTGTTATTATATGCCTTGTTTTCTGTCAAGACACC
ATGATTCCTGGTAACCGAATGCTGATGGTCGTTTTATTATGCCAAGTCCTGCTAGGAGGC
GCGAGCCATGCTAGTTTGATACCTGAGACGGGGAAGAAAAAAGTCGCCGAGATTCAGGGC
CACGCGGGAGGACGCCGCTCAGGGCAGAGCCATGAGCTCCTGCGGGACTTCGAGGCGACA
CTTCTGCAGATGTTTGGGCTGCGCCGCCGCCCGCAGCCTAGCAAGAGTGCCGTCATTCCG
GACTACATGCGGGATCTTTACCGGCTTCAGTCTGGGGAGGAGGAGGAAGAGCAGATCCAC
AGCACTGGTCTTGAGTATCCTGAGCGCCCGGCCAGCCGGGCCAACACCGTGAGGAGCTTC
CACCACGAAGAACATCTGGAGAACATCCCAGGGACCAGTGAAAACTCTGCTTTTCGTTTC
CTCTTTAACCTCAGCAGCATCCCTGAGCGCGAGGTGATCTCCTCTGCAGAGCTTCGGCTC
TTCCTGGAGCAGGTGGACCAGNGCCCTGACTGNGCAAGGNGCTTCCCCGTATAACATTNA
TGAGGNTATGAAGCCCCCAGCAAACGTGGTGCCTGGGCACCTCATCACACGACTACTGGA
CACGAGACTGGTTCACCACATGTGACACGCTGGGACACTTTTGATGTGAGCCCTGCNGTC
CTTCGCTGNACCTGGGAGAGCAGCCAACTATGGCCTAGC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_130851
ORF Size 1227 bp
Insert Size 1600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_130851.1, NP_570912
RefSeq Size 1779
RefSeq ORF 1227
Locus ID 652
Cytogenetics 14q22.2
Domains TGFb_propeptide, TGF-beta
Protein Families Stem cell relevant signaling - TGFb/BMP signaling pathway, Secreted Protein, Adult stem cells, Cancer stem cells, Embryonic stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways Hedgehog signaling pathway, TGF-beta signaling pathway, Pathways in cancer, Basal cell carcinoma
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. This protein regulates heart development and adipogenesis. Mutations in this gene are associated with orofacial cleft and microphthalmia in human patients. The encoded protein may also be involved in the pathology of multiple cardiovascular diseases and human cancers. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variants 1 and 2. Variants 1, 2 and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.