LBH (NM_030915) Human Untagged Clone

CAT#: SC109114

Reviews ()
Write a review

LBH (untagged)-Human limb bud and heart development homolog (mouse) (LBH)



  "NM_030915" in other vectors (6)

Reconstitution Protocol

USD 150.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol LBH
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC109114 sequence for NM_030915 edited (data generated by NextGen Sequencing)
ATGTCTATATATTTCCCCATTCACTGCCCCGACTATCTGAGATCGGCCAAGATGACTGAG
GTGATGATGAACACCCAGCCCATGGAGGAGATCGGCCTCAGCCCCCGCAAGGATGGCCTT
TCCTACCAGATCTTCCCAGACCCGTCAGATTTTGACCGCTGCTGCAAACTGAAGGACCGT
CTGCCCTCCATAGTGGTGGAACCCACAGAAGGGGAGGTGGAGAGCGGGGAGCTCCGGTGG
CCCCCTGAGGAGTTCCTGGTCCAGGAGGATGAGCAAGATAACTGCGAAGAGACAGCGAAA
GAAAATAAAGAGCAGTAG

Clone variation with respect to NM_030915.3
>OriGene 5' read for NM_030915 unedited
GGTTCAAATTTTGTAATACGACTCACTTATAGGGCGGCCGCGAATTCGCACGAGGTGGAG
AGCGGGGAGTTGTGTCCACCTTGCCGACGTCGCTAGCCGTGGGGCTGTCCTGGGAAGGCG
GACGGCGAGCGCCCGGTGTCCGCACTCGGCCGCCTGCCGTGCCCGTCTGCGCCCGTGTCA
TCCTCACTCGGGACGCAGGGACCGTTTTTAAATCACAGGGGCGTGTGTCAGCCTGCCCTA
GGACTTCATGTCTATATATTTCCCCATTCACTGCCCCGACTATCTGAGATCGGCCAAGAT
GACTGAGGTGATGATGAACACCCAGCCCATGGAGGAGATCGGCCTCAGCCCCCGCAAGGA
TGGCCTTTCCTACCAGATCTTCCCAGACCCGTCAGATTTTGACCGCTGCTGCAAACTGAA
GGACCGTCTGCCCTCCATAGTGGTGGAACCCACAGAAGGGGAGGTGGAGAGCGGGGAGCT
CCGGTGGCCCCCTGAGGAGTTCCTGGTCCAGGAGGATGAGCAAGATAACTGCGAAGAGAC
AGCGAAAGAAAATAAAGAGCAGTAGAGTCCCTGTGGACTCCCATGGGTCATACCAGCCAG
CATCTGTTCCTGAACTGTGTTTTTCCCATCATGACGGAAGAAGAGAGTGAGCCGCAATTG
TTCTGAAAATGTCAAACGAGGCTTCTGTTTTGCACCTGCAGATCACCGAGTTGGCTTTCT
TTTCTTTTCTTGCCTTTTTTTTTTTTTGAAATTTGCCGGCAGTGGAGCCCTCTGACCATT
TGCAAGGCCCTCTGAGAAAGGAAACTGCTTACAGCCACGGGTTTATTGGGTGAGGGGAAC
CAGTGCTGTTTTTGAAATCATTATCTGACTCAGGCCGCCTATTAAAGGCAGTGGCTGGGA
TCCACAGGGTCTTG
>OriGene 3' read for NM_030915 unedited
CCGCTCTCTAGTATCGAGTTTTTTTTTTTTTTTTTTGCATTTTCAAACTTTATTTACAAC
TGTCACAGTGACAAAAAGTAGTTTGGAAAAAAAAAAAAGCTAGTTTCTCCCTGAGCCTCA
AAAAAGAACAGATAGAAGTTACAGGAGGTTCATCTCACAACAGGCATTTTTACTGAAATA
CTAGGAATTTTTTCAATACAATCAGTTAGAAATACACACAAATTACTTGAAAAAAAAAAA
AAGAGGAGGCCAGATAGGAGCTCAGCCACTTGTCCAAGAGCAGCTGGGTCCCCCCAGCAG
GCTCCACCGCTGAGGGTCCTGACATTAGCTGTCAGCCCCTGGCCTGCTCAGACTGCAAAC
GGTCATACAAAGTGGTCTAGGGACCAGCAAAAATAATAAACCACCCCCATAAACAGACAC
ATACACAAAGTAGATTTGTTACGCAGTTTACAAGCATGTTCCCATCACACAGCAAGACCA
GGACAGGTGATTCAGGGTAGCAGATAAGGGAAGACACCAAAACACAGGAATTGAAAAGGC
AAGACCCCCGTCCACAAGGGGAGGCGAGGGAATGAGAGTATGGATGAACCACTCTCTGCA
GCCATAACAGAACGAAGCGGCGAGCAAGAGAGAGGAAAGCCCCTCTCGGTGCATGCTGCC
GGCCTCTCCACTTCTGCGAGGAGTTGGAAAGAGTTATTGCCATTGATGTGTGTCACACAG
GCAGACAACAGATGGAGGATCAAGGGGTGCCGGCGACCATTGGCTTCCCAGAACGTATTT
CGCGGACTGCTGTGTTCACATGCACCCTCGTCTTCTTGCCCGGATCCCCAGAGCCCAAGA
CCCTGAGGNATTAATACAGCTTTTACCCACGTCAGACTGAGGTCACCCGGACTGACTGAA
ACCTGAGGGAATGCCGGGTGCTTGGTGGCCGAGTTATCTCAGGAGGCTTGAACCACCTTG
GCCACCGACTGTCTTGAGGACTGAATTC
Restriction Sites NotI-NotI     
ACCN NM_030915
Insert Size 2880 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030915.1, NP_112177.1
RefSeq Size 2955 bp
RefSeq ORF 318 bp
Locus ID 81606
UniProt ID Q53QV2
Cytogenetics 2p23.1
Gene Summary Transcriptional activator which may act in mitogen-activated protein kinase signaling pathway.[UniProtKB/Swiss-Prot Function]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.