EMA(MUC1) (NM_002456) Human Untagged Clone

CAT#: SC108321

MUC1 (untagged)-Human mucin 1, cell surface associated (MUC1), transcript variant 1

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EMA(MUC1) (NM_002456) Human Untagged Clone
Symbol MUC1
Synonyms ADMCKD; ADMCKD1; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC108321 sequence for NM_002456 edited (data generated by NextGen Sequencing)
ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGTT
GTTACAGGTTCTGGTCATGCAAGCTCTACCCCAGGTGGAGAAAAGGAGACTTCGGCTACC
CAGAGAAGTTCAGTGCCCAGCTCTACTGAGAAGAATGCTTTGTCTACTGGGGTCTCTTTC
TTTTTCCTGTCTTTTCACATTTCAAACCTCCAGTTTAATTCCTCTCTGGAAGATCCCAGC
ACCGACTACTACCAAGAGCTGCAGAGAGACATTTCTGAAATGTTTTTGCAGATTTATAAA
CAAGGGGGTTTTCTGGGCCTCTCCAATATTAAGTTCAGGCCAGGATCTGTGGTGGTACAA
TTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAAT
CAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGT
GATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCG
CTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCT
GTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTGGACATCTTTCCAGCCCGGGATACC
TACCATCCTATGAGCGAGTACCCCACCTACCACACCCATGGGCGCTATGTGCCCCCTAGC
AGTACCGATCGTAGCCCCTATGAGAAGGTTTCTGCAGGTAATGGTGGCAGCAGCCTCTCT
TACACAAACCCAGCAGTGGCAGCCACTTCTGCCAACTTGTAG

Clone variation with respect to NM_002456.5
66 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002456 unedited
TGGGGNNGCAATCAACTTGNGNATTTTGTNAACACGTTCTTCACTNTCAGGGNCGGCACG
CGCAATTCGGCACCACATCTGTTCTGCCCCCTCCCCACCCATTTCACCACCACCATGACA
CCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGTTGTTACA
GGTTCTGGTCATGCAAGCTCTACCCCAGGTGGAGAAAAGGAGACTTCGGCTACCCAGAGA
AGTTCAGTGCCCAGCTCTACTGAGAAGAATGCTTTGTCTACTGGGGTCTCTTTCTTTTTC
CTGTCTTTTCACATTTCAAACCTCCAGTTTAATTCCTCTCTGGAAGATCCCAGCACCGAC
TACTACCAAGAGCTGCAGAGAGACATTTCTGAAATGTTTTTGCAGATTTATAAACAAGGG
GGTTTTCTGGGCCTCTCCAATATTAAGTTCAGGCCAGGATCTGTGGTGGTACAATTGACT
CTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGNAGACACAGTTCAATCAGTAT
AAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTG
CCATTTCCTTTCTCTGGCCCATCTGGGGCTGGGGTCCCAAGCCTGGGGCATCCCCCCTCT
GGGGCTGGGCCTGGGTTCCGGGTTGCCCCTGGCATTGGCTAACCCAATGGCCTTGGGCGT
GCTGTCAAGGCCCCCCAAAAAAAACTCAGGGGCAATTGGAAATTTTTTTCCCCCCGGGGG
AACCCCCCCCCCCCCTTTAGAGGGGTTTCCCCCACTTTAACAAACCCTTTGGGGCGCCTT
GGGGTGCCCCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002456 unedited
GGGGGACTTGGGGATGGCAATTCCCATGNCCAGNANAGCACTGGGGCAGGGTCACAGGGA
TGCCACCCGGGATCTGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTT
TTTTTTTTTTTTTTTTTTTGCGCAGTGGGAGACCACGTTTTATTCAGTCCAGTTCAGGAT
CCCCGCTATCTCAGGGCTCTCTGGGCCAGTCCTCCTGGGAGCCCCCACCACAACACTTCC
CAGGCATGAGCCCTCAGGGGCCCACATGAGCTTCCACACACTGAGAAGTGTCCGAGAAAT
TGGTGGGGCCTCTGAAGGAGGCTGTGAGCAGCCCACCTGAACTCCCAGCTCACCAGCCCA
AACAGGGTGCAGGGGCTCTGGCCCTGAAGAACCTGAGTGGAGTGGAATGGCACTGGCTGG
CCACTCAGCTCAGCGGGCGACGTGCCCCTACAAGTTGGCAGAAGTGGCTGCCACTGCTGG
GTTTGTGTAAGAGAGGCTGCTGCCACCATTACCTGCAGAAACCTTCTCATAGGGGCTACG
ATCGGTACTGCTAGGGGGCACATAGCGCCCATGGGTGTGGTAGGTGGGGTACTCGCTCAT
AGGATGGTAGGTATCCCGGGCTGGAAAGATGTCCAGCTGCCCGTAGTTCTTTCGGCGGCA
CTGACAGACAGCCAAGGCAATGAGATAGACAATGGCCAGCGCAACCAGAACACAGACCAG
CACCAGCAGCGCGATGCCCCAGCCTGGCACCCCAGCCCCAGACTGGGCAGAGAAAGGAAA
TGGCACATCACTCACGCTGACGTCTGAGATCGTCAGGTTATATCGAGAGGCTGCTTCCGT
TTTATACTGATTGAACTGTGTCTCCACGTCGTGGACATTGATGGTACCTT
Tag Tag Free
ACCN NM_002456
ORF Size 822 bp
Insert Size 1300
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002456.4, NP_002447
RefSeq Size 1209
RefSeq ORF 822
Locus ID 4582
Cytogenetics 1q22
Protein Families Secreted Protein, Transmembrane, Druggable Genome
Gene Summary This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011].
Transcript Variant: This variant (1) represents isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.