HSPA4 (NM_002154) Human Untagged Clone

CAT#: SC107571

HSPA4 (untagged)-Human heat shock 70kDa protein 4 (HSPA4)

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HSPA4 (NM_002154) Human Untagged Clone
Symbol HSPA4
Synonyms APG-2; HEL-S-5a; HS24/P52; hsp70; hsp70RY; HSPH2; RY
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107571 sequence for NM_002154 edited (data generated by NextGen Sequencing)
ATGTCGGTGGTGGGCATAGACCTGGGCTTCCAGAGCTGCTACGTCGCTGTGGCCCGCGCC
GGCGGCATCGAGACTATCGCTAATGAGTATAGCGACCGCTGCACGCCGGCTTGCATTTCT
TTTGGTCCTAAGAATCGTTCAATTGGAGCAGCAGCTAAAAGCCAGGTAATTTCTAATGCA
AAGAACACAGTCCAAGGATTTAAAAGATTCCATGGCCGAGCATTCTCTGATCCATTTGTG
GAGGCAGAAAAATCTAACCTTGCATATGATATTGTGCAGTTGCCTACAGGATTAACAGGT
ATAAAGGTGACATATATGGAGGAAGAGCGAAATTTTACCACTGAGCAAGTGACTGCCATG
CTTTTGTCCAAACTGAAGGAGACAGCCGAAAGTGTTCTTAAGAAGCCTGTAGTTGACTGT
GTTGTTTCGGTTCCTTGTTTCTATACTGATGCAGAAAGACGATCAGTGATGGATACAACA
CAGATTGCTGGTCTTAATTGCTTGCGATTAATGAATGAAACCACTGCAGTTGCTCTTGCA
TATGGAATCTATAAGCAGGATCTTCCTGCCTTAGAAGAGAAACCAAGAAATGTAGTTTTT
GTAGACATGGGCCACTCTGCTTATCAAGTTTCTGTATGTGCATTTAATAGAGGAAAACTG
AAAGTTCTGGCCACTGCATTTGACACGACATTGGGAGGTAGAAAATTTGATGAAGTGTTA
GTAAATCACTTCTGTGAAGAATTTGGGAAGAAATACAAGCTAGACATTAAGTCCAAAATC
CGTGCATTATTACGACTCTCTCAGGAGTGTGAGAAACTCAAGAAATTGATGAGTGCAAAT
GCTTCAGATCTCCCTTTGAGCATTGAATGTTTTATGAATGATGTTGATGTATCTGGAACT
ATGAATAGAGGCAAATTTCTGGAGATGTGCAATGATCTCTTAGCTAGAGTGGAGCCACCA
CTTCGTAGTGTTTTGGAACAAACCAAGTTAAAGAAAGAAGATATTTATGCAGTGGAGATA
GTTGGTGGTGCTACACGAATCCCTGCGGTAAAAGAGAAGATCAGCAAATTTTTCGGTAAA
GAACTTAGTACAACATTAAATGCTGATGAAGCTGTCACTCGAGGCTGTGCATTGCAGTGT
GCCATCTTATCGCCTGCTTTCAAAGTCAGAGAATTTTCTATCACTGATGTAGTACCATAT
CCAATATCTCTGAGATGGAATTCTCCAGCTGAAGAAGGGTCAAGTGACTGTGAAGTCTTT
TCCAAAAATCATGCTGCTCCTTTCTCTAAAGTTCTTACATTTTATAGAAAGGAACCTTTC
ACTCTTGAGGCCTACTACAGCTCTCCTCAGGATTTGCCCTATCCAGATCCTGCTATAGCT
CAGTTTTCAGTTCAGAAAGTCACTCCTCAGTCTGATGGCTCCAGTTCAAAAGTGAAAGTC
AAAGTTCGAGTAAATGTCCATGGCATTTTCAGTGTGTCCAGTGCATCTTTAGTGGAGGTT
CACAAGTCTGAGGAAAATGAGGAGCCAATGGAAACAGATCAGAATGCAAAGGAGGAAGAG
AAGATGCAAGTGGACCAGGAGGAACCACATGTTGAAGAGCAACAGCAGCAGACACCAGCA
GAAAATAAGGCAGAGTCTGAAGAAATGGAGACCTCTCAAGCTGGATCCAAGGATAAAAAG
ATGGACCAACCACCCCAAGCCAAGAAGGCAAAAGTGAAGACCAGTACTGTGGACCTGCCA
ATCGAGAATCAGCTATTATGGCAGATAGACAGAGAGATGCTCAACTTGTACATTGAAAAT
GAGGGTAAGATGATCATGCAGGATAAACTGGAGAAGGAGCGGAATGATGCTAAGAACGCA
GTGGAGGAATATGTGTATGAAATGAGAGACAAGCTTAGTGGTGAATATGAGAAGTTTGTG
AGTGAAGATGATCGTAACAGTTTTACTTTGAAACTGGAAGATACTGAAAATTGGTTGTAT
GAGGATGGAGAAGACCAGCCAAAGCAAGTTTATGTTGATAAGTTGGCTGAATTAAAAAAT
CTAGGTCAACCTATTAAGATACGTTTCCAGGAATCTGAAGAACGACCAAAATTATTTGAA
GAACTAGGGAAACAGATCCAACAGTATATGAAAATAATCAGCTCTTTCAAAAACAAGGAG
GACCAGTATGATCATTTGGATGCTGCTGACATGACAAAGGTAGAAAAAAGCACAAATGAA
GCAATGGAGTGGATGAATAACAAGCTAAATCTGCAGAACAAGCAGAGTTTGACCATGGAT
CCAGTTGTCAAGTCAAAAGAGATTGAAGCTAAAATTAAGGAGCTGACAAGTACTTGTAGC
CCTATAATTTCAAAGCCCAAACCCAAAGTGGAACCTCCAAAAGAGGAACAAAAAAATGCA
GAGCAGAATGGACCAGTGGATGGACAAGGAGACAACCCAGGCCCCCAGGCTGCTGAGCAG
GGTACAGACACAGCTGTGCCTTCGGATTCAGACAAGAAGCTTCCTGAAATGGACATTGAT
TGA

Clone variation with respect to NM_002154.3
475 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002154 unedited
ATTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGCCGCTACCGGCGC
CTCCTCTGCGGCCACTGAGCCGGAGCCGGCCTGAGCAGCGCTCTCGGTTGCAGTACCCAC
TGGAAGGACTTAGGCGCTCGCGTGGACACCGCAAGCCCCTCAGTAGCCTCGGCCCAAGAG
GCCTGCTTTCCACTCGCTAGCCCCGCCGGGGGTCCGTGTCCTGTCTCGGTGGCCGGACCC
GGGCCCGAGCCCGAGCAGTAGCCGGCGCCATGTCGGTGGTGGGCATAGACCTGGGCTTCC
AGAGCTGCTACGTCGCTGTGGCCCGCGCCGGCGGCATCGAGACTATCGCTAATGAGTATA
GCGACCGCTGCACGCCGGCTTGCATTTCTTTTGGTCCTAAGAATCGTTCAATTGGAGCAG
CAGCTAAAAGCCAGGTAATTTCTAATGCAAAGAACACAGTCCAAGGATTTAAAAGATTCC
ATGGCCGAGCATTCTCTGATCCATTTGTGGAGGCAGAAAAATCTAACCTTGCATATGATA
TTGTGCAGTTGCCTACAGGATTAACAGGTATAAAGGTGACATATATGGAGGAAGAGCGAA
ATTTTACCACTGAGCAAGTGACTGCCATGCTTTTGTCCAAACTGAAGGAGACAGCCGAAA
GTGTTCTTAAGAAGCCTGTAGTTGACTGTGTTGTTTCGGTTCCTTGTTTCTATACTGATG
CAGAAAGACGATCAGTGATGGATACAACACAGATTGCTGGTCTTAATTGCTTGCGATAAT
GAATGACCCACTGCAGTTGCTCTTGCATATGGAATCTNATAGCAGGATCTTCCTGCCTTA
GAAGAGAAACCAAGAATGTAGTTTTGTAGACATGGN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002154 unedited
TCCCATGCTTCCCACCCGTGTCTCTGTTCAGGCAAAAGTTATGACCCGCGGCCGCAATCT
AGAGTCGAGCTTTTTTTTTTTTTTTTTGCTTTATAATAGTCTGTTTTAATAGAAACATGT
GTTGGAATCAATCAATGTCCATTTCAGGAAGCTTCTTGTCTGAATCCGAAGGCACAGCTG
TGTCTGTACCCTGCTCAGCAGCCTGGGGGCCTGGGTTGTCTCCTTGTCCATCCACTGGTC
CATTCTGCTCTGCATTTTTTTGTTCCTCTTTTGGAGGTTCCACTTTGGGTTTGGGCTTTG
AAATTATAGGGCTACAAGTACTTGTCACCTCCTTAATTTTAGCTTCAATCTCTTTTGACT
TGACAACTGGATCCATGGTCAAACTCTGCTTGTTCTGCAGATTTAGCTTGTTATTCATCC
ACTCCATTGCTTCATTTGTGCTTTTTTCTACCTTTGTCATGTCAGCAGCATCCAAATGAT
CATACTGGTCCTCCTTGTTTTTGAAAGAGCTGATTATTTTCATATACTGTTGGATCTGTT
TCCCTAGTTCTTCAAATAATTTTGGTCGTTCTTCAGATTCCTGGAAACGTATCTTAATAG
GTTGACCTAGATTTTTTAATTCAGCCAACTTATCAACATAAACTTGCTTTGGCTGGTCTT
CTCCATCCTCATANCACCAATTTTCAGTATCTTTCCGTTTCAAAGTAAAACTGTTACGAT
CATCTTNCCTCCACAACTTTTCTATTTACCACTAAGCTTGTCTCTCTTTTCATACACATA
TTTCCTCCT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002154
ORF Size 2523 bp
Insert Size 3000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002154.3, NP_002145
RefSeq Size 3385
RefSeq ORF 2523
Locus ID 3308
Cytogenetics 5q31.1
Protein Families ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Antigen processing and presentation
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations