CBLB(CBLB) (NM_170662) Human Untagged Clone

CAT#: SC107022

CBLB (untagged)-Human Cas-Br-M (murine) ecotropic retroviral transforming sequence b (CBLB)

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CBLB(CBLB) (NM_170662) Human Untagged Clone
Symbol CBLB
Synonyms Cbl-b; Nbla00127; RNF56
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC107022 sequence for NM_170662 edited (data generated by NextGen Sequencing)
ATGGCAAACTCAATGAATGGCAGAAACCCTGGTGGTCGAGGAGGAAATCCCCGAAAAGGT
CGAATTTTGGGTATTATTGATGCTATTCAGGATGCAGTTGGACCCCCTAAGCAAGCTGCC
GCAGATCGCAGGACCGTGGAGAAGACTTGGAAGCTCATGGACAAAGTGGTAAGACTGTGC
CAAAATCCCAAACTTCAGTTGAAAAATAGCCCACCATATATACTTGATATTTTGCCTGAT
ACATATCAGCATTTACGACTTATATTGAGTAAATATGATGACAACCAGAAACTTGCCCAA
CTCAGTGAGAATGAGTACTTTAAAATCTACATTGATAGCCTTATGAAAAAGTCAAAACGG
GCAATAAGACTCTTTAAAGAAGGCAAGGAGAGAATGTATGAAGAACAGTCACAGGACAGA
CGAAATCTCACAAAACTGTCCCTTATCTTCAGTCACATGCTGGCAGAAATCAAAGCAATC
TTTCCCAATGGTCAATTCCAGGGAGATAACTTTCGTATCACAAAAGCAGATGCTGCTGAA
TTCTGGAGAAAGTTTTTTGGAGACAAAACTATCGTACCATGGAAAGTATTCAGACAGTGC
CTTCATGAGGTCCACCAGATTAGCTCTGGCCTGGAAGCAATGGCTCTAAAATCAACAATT
GATTTAACTTGCAATGATTACATTTCAGTTTTTGAATTTGATATTTTTACCAGGCTGTTT
CAGCCTTGGGGCTCTATTTTGCGGAATTGGAATTTCTTAGCTGTGACACATCCAGGTTAC
ATGGCATTTCTCACATATGATGAAGTTAAAGCACGACTACAGAAATATAGCACCAAACCC
GGAAGCTATATTTTCCGGTTAAGTTGCACTCGATTGGGACAGTGGGCCATTGGCTATGTG
ACTGGGGATGGGAATATCTTACAGACCATACCTCATAACAAGCCCTTATTTCAAGCCCTG
ATTGATGGCAGCAGGGAAGGATTTTATCTTTATCCTGATGGGAGGAGTTATAATCCTGAT
TTAACTGGATTATGTGAACCTACACCTCATGACCATATAAAAGTTACACAGGAACAATAT
GAATTATATTGTGAAATGGGCTCCACTTTTCAGCTCTGTAAGATTTGTGCAGAGAATGAC
AAAGATGTCAAGATTGAGCCTTGTGGGCATTTGATGTGCACCTCTTGCCTTACGGCATGG
CAGGAGTCGGATGGTCAGGGCTGCCCTTTCTGTCGTTGTGAAATAAAAGGAACTGAGCCC
ATAATCGTGGACCCCTTTGATCCAAGAGATGAAGGCTCCAGGTGTTGCAGCATCATTGAC
CCCTTTGGCATGCCGATGCTAGACTTGGACGACGATGATGATCGTGAGGAGTCCTTGATG
ATGAATCGGTTGGCAAACGTCCGAAAGTGCACTGACAGGCAGAACTCACCAGTCACATCA
CCAGGATCCTCTCCCCTTGCCCAGAGAAGAAAGCCACAGCCTGACCCACTCCAGATCCCA
CATCTAAGCCTGCCACCCGTGCCTCCTCGCCTGGATCTAATTCAGAAAGGCATAGTTAGA
TCTCCCTGTGGCAGCCCAACAGGTTCACCAAAGTCTTCTCCTTGCATGGTGAGAAAACAA
GATAAACCACTCCCAGCACCACCTCCTCCCTTAAGAGATCCTCCTCCACCGCCACCTGAA
AGACCTCCACCAATCCCACCAGACAATAGACTGAGTAGACACATCCATCATGTGGAAAGC
GTGCCTTCCAGAGACCCGCCAATGCCTCTTGAAGCATGGTGCCCTCGGGATGTGTTTGGG
ACTAATCAGCTTGTGGGATGTCGACTCCTAGGGGAGGGCTCTCCAAAACCTGGAATCACA
GCAAGTTCAAATGTCAATGGAAGGCACAGTAGAGTGGGCTCTGACCCAGTGCTTATGCGG
AAACACAGACGCCATGATTTGCCTTTAGAAGGAGCTAAGGTCTTTTCCAATGGTCACCTT
GGAAGTGAAGAATATGATGTTCCTCCCCGGCTTTCTCCTCCTCCTCCAGTTACCACCCTC
CTCCCTAGCATAAAGTGTACTGGTCCGTTAGCAAATTCTCTTTCAGAGAAAACAAGAGAC
CCAGTAGAGGAAGATGATGATGAATACAAGATTCCTTCATCCCACCCTGTTTCCCTGAAT
TCACAACCATCTCATTGTCATAATGTAAAACCTCCTGTTCGGTCTTGTGATAATGGTCAC
TGTATGCTGAATGGAACACATGGTCCATCTTCAGAGAAGAAATCAAACATCCCTGACTTA
AGCATATATTTAAAGGGAGATGTTTTTGATTCAGCCTCTGATCCCGTGCCATTACCACCT
GCCAGGCCTCCAACTCGGGACAATCCAAAGCATGGTTCTTCACTCAACAGGACGCCCTCT
GATTATGATCTTCTCATCCCTCCATTAGGTGAAGATGCTTTTGATGCCCTCCCTCCATCT
CTCCCACCTCCCCCACCTCCTGCAAGGCATAGTCTCATTGAACATTCAAAACCTCCTGGC
TCCAGTAGCCGGCCATCCTCAGGACAGGATCTTTTTCTTCTTCCTTCAGATCCCTTTGTT
GATCTAGCAAGTGGCCAAGTTCCTTTGCCTCCTGCTAGAAGGTTACCAGGTGAAAATGTC
AAAACTAACAGAACATCACAGGACTATGATCAGCTTCCTTCATGTTCAGATGGTTCACAG
GCACCAGCCAGACCCCCTAAACCACGACCGCGCAGGACTGCACCAGAAATTCACCACAGA
AAACCCCATGGGCCTGAGGCGGCATTGGAAAATGTCGATGCAAAAATTGCAAAACTCATG
GGAGAGGGTTATGCCTTTGAAGAGGTGAAGAGAGCCTTAGAGATAGCCCAGAATAATGTC
GAAGTTGCCCGGAGCATCCTCCGAGAATTTGCCTTCCCTCCTCCAGTATCCCCACGTCTA
AATCTATAG

Clone variation with respect to NM_170662.3
1581 g=>a;1863 g=>a
5' Read Nucleotide Sequence
>OriGene 5' read for NM_170662 unedited
GGGCGGCCCGCGAATTCGCACGAGGCCTGCTAGTGCTGCTGCGGCGTCCCGCGGCCTCCC
CGAGTCGGGCGGGAGGGGAGAGCGGGTGTGGATTTGTCTTGACGGTAATTGTTGCGTTTC
CACGTCTCGGAGGCCTGCGCGCTGGGTTGCTCCTTCTTCGGGAGCGAGCTGTTCTCAGCG
ATCCCACTCCCAGCCGGGGCTCCCCACACACACTGGGCTGCGTGCGTGTGGAGTGGGACC
CGCGCACACGCGTGTCTCTGGACAGCTACGGCGCCGAAAGAACTAAAATTCCAGATGGCA
AACTCAATGAATGGCAGAAACCCTGGTGGTCGAGGAGGAAATCCCCGAAAAGGTCGAATT
TTGGGTATTATTGATGCTATTCAGGATGCAGTTGGACCCCCTAAGCAAGCTGCCGCAGAT
CGCAGGACCGTGGAGAAGACTTGGAAGCTCATGGACAAAGTGGTAAGACTGTGCCAAAAT
CCCAAACTTCAGTTGAAAAATAGCCCACCATATATACTTGATATTTTGCCTGATACATAT
CAGCATTTACGACTTATATTGAGTAAATATGATGACAACCAGAAACTTGCCCAACTCAGT
GAGAATGGAGTACTTTAAAATCTACATTGATAGCCTTATGAAAAAGTCAAAACGGGCAAT
AAGACTCTTNANAGAAGGCAAGGGAGAGAATGTATTGAAGAACAGTCACAGGACAGACGA
AATCTCACAAACTGTCCCTAATCTTCAGTCACATGCTGGCAGAATCAAGCATCCTCCCCA
TGGTCATTCCAGGGAGATACTTTCGATACAAAGCAGAGCTGCTGATCTGGGGAAAGAGTT
TTGGAGACAAACATCGACAATGGAAGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_170662 unedited
NNTTTTTTAGCTTGNACCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTT
GCATTAGTTTGATCAGTTGAAAATCAGAACCTTCAAAGCATCTTGTGAATGAGAGAAATG
GAACTGGACCTGGGCAAGGCATGGGGATGGTAGAGATCCATATGAATAAATGATTTAGCT
GTTGATGTGGACAGCAAGAGAGTTGGTGGGAAATGTTACAGCAGACCTGACCACGCTACA
AAGGGTCTGTGAAGAACACAGTACAGGTATCAAAACACCAAAACAAAACTAAACTAAAAA
CAAGAACAAACTGCAACTTTGCCAAACTGTAAACAAGGTAAAGCATTTCACAGGTTCAAA
GTTCAAGGGAAGTAAACGTCTTTAAATTATTTTTGTCAGTTCAACCCTGATTTAAAAATA
TGGCTAGCAAAAACAAGGAAGCCACAGCTGTCGACATCCTGAGCAAGCATCGGTCTCCTT
TGAGAAGCTGCACTCCCAAGCCTCTTCTCAAGCTGCTACACGAGGAGGAGACACTTCTCT
CTTGAATTCCATCTCAGTTCTCTTTATTTCCACACTCTTGGAATACATCGATTGCTTTCC
ATTTTGGTGTCTACAGTTCTGGCTGCTATAGATTTAGACGTGGGGATACTGGAGGAAGGG
AAGGCAAATTCTCGGAGGATGCTNCGGGGCACTTCGACATTATTCTGGGCTATCTCTAAG
GCTCTCTTCACCTCTTCAAGGCATACCCTCTCCATGGAGTTTGCAATTTTGCATCGAATT
TTCCATGCCGCTCAGCCTGGGGGTTTTCTGTGGTGAATTCTGGTGCAGCTTGGCGGCCGG
TTTAGGGGGGTCTGGTTGGCGCTGTAACATTTGACTGAAGAGTGACTAGCCCGGGAGTTC
GGAAGTTGCATTC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_170662
ORF Size 2949 bp
Insert Size 3580
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_170662.3, NP_733762
RefSeq Size 3976
RefSeq ORF 2949
Locus ID 868
Cytogenetics 3q13.11
Protein Families Druggable Genome
Protein Pathways ErbB signaling pathway, Ubiquitin mediated proteolysis, Endocytosis, Jak-STAT signaling pathway, T cell receptor signaling pathway, Insulin signaling pathway, Pathways in cancer, Chronic myeloid leukemia
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations