ADCY5(ADCY5) (AK098381) Human Untagged Clone

CAT#: SC102665

(untagged)-Human cDNA FLJ25515 fis, clone CBR06479

USD 618


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ADCY5(ADCY5) (AK098381) Human Untagged Clone
Symbol ADCY5
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for AK098381, the custom clone sequence may differ by one or more nucleotides


GTGTTTCTGAGAAAAATATTTATTAAATAAAACAAAACAAGTTCTCCGTGCCCTTCTTTAGACTATGCTA
GTTGTATGCGTGTAAGAGACACACAAGCAAACGAGGACGCCACTCGGGGGGAGGGCGGGGATCCCCACTT
GTCTTTTTTGTATTTTTTATTTTGTATTATTGAAAGCCTTGGAGATCTCACAGATAGATATGCCAAATTC
TATATTTTGTAAATTCTCTATATTAGAAAACAGCTGTGCACAGCAGGGCGGGTGTGCTCATTTGTACTGT
GTGTATGTCGGTGTATGTACTGGTGTATATGTGTGTGTGTTCATGCTGTGGAACTGGTCTCACACAGGAT
GTGTTTCCCTCATTTCAGATTTGGCAGTTTTGGGTTTTCCAAGGTACCACCAGAGCAGTGGGTGTGTGCT
TTTGGGGTACCATATGCTCAGATTAAGTAGGAGGATGCATGGACACACTGCCCCATCTTTTCTGACACAC
GCACACGTATGTACACACATGCACACACCCTCCTTCCCCTAAGCAAAACGCAGATGGAATAAGAAAACAA
AAAGCTGCTTTCCCATCCCAGGCCGAGCTGGAACCAAGGGAAGCAATCTCATCCTGCGACAGGCAGTGTG
GTGCCCTCCACACCCTGAGATTTCAGACGTTTGCGGCTTACAGAGGCAGCGCCCACAGATTCCAGAGTGC
TTACAGAAGGCCAGGTGCTTTGCAGGCTGGGACGAGGAAGCCAAGCCTCCCTGGCCTACTCAGTTGGCCA
AGGTGCAGGTGGCTCTTCCTGGAGATGTTCACTCAGACTGGGGGATGCAATGTGCAGCCTTCAGGTTTGC
GGAAAGGGAGTGGCCTTGACCTCCACCGGCAAACCAGGCAGAGGAATGGGTAGAGCCCAGCTTTAGAGTC
CACAGGGAAAGCTAGCAGGAATTTTGTTTTAGTGGGAGGGGGCAGTTAAACATACCAAGAAAAAAATACT
ATTTTTATAACCTATGAGGAAGACATTTGGAAAATGATACTCTAGCACAGAATTCAGTGGAATCCTTAGG
GCCCATGCCCAAATCTTTCCATTGCTTCTCAGGTTAGAATGATCTTCACCTCCAACATGAGCTTGGAGGT
GATGAGGCAGTGGCTCTGTGCCAGCTGCCACAATGTGACTTTGATGTCCACCTGTACCACCTCTCACTGG
GCTCTAGCACCACCCTCCCCTCCCCGCACACCAACTGAACACAGCTCTGAGAAGCAAAGTGTGTGGACCC
AAAACTGCCAAGCCTGAGTCTGTCCCGTGCTTCTGCTGCTCCATCCTTTGAGTTCTGCATTGCCATCCTG
ACGTCGGCCACAGGAGGCCTGCTTTCTTCCAGCTGTTGTTCTCAAGTTCCCTGCCCCTCCACATCGCCCG
CCAGTGGTGTTGGGTTTTCGTTCTGCTTCCAACCTGAGTAAAGTGTGTGTGCTGAGTTCATCCCATGTTC
TCCCATGGTCATGGCTTCCCGGCCCCATGGGGACCCCTCTCCCATCCCAGCAGTGACTGGTGACAGTGTG
CAGGTGCAGTGCTAGCTCTTCGTTCCCTCTAAAGGGTGTGCACTCTTTTTATTCCTACTCTTGCAAAAAC
AGATACGATTATGATTTCCCATGGAAATTGAAAAGTCTATTTAAATAATTTAACTATTAAACACTTTCAC
TGGT


5' Read Nucleotide Sequence
>OriGene 5' read for AK098381 unedited
NGGTTCAGATTAGTATACGACTCATATAGGCGGCCGCGAAATTCGCACGAGGCACAGACA
GTGCCCTAGGAGGGAAACAGAACTAATTACGAGGGGGAGGCAAGAGGACGCCAAGCAAGG
AGTGGTGATTCTGAGAAAAATATTTATTAAATAAAACAAAACAAGTTCTCCGTGCCCTTC
TTTAGACTATGCTAGTTGTATGCGTGTAAGAGACACACAAGCAAACGAGGACGCCACTCG
GGGGGAGGGCGGGGATCCCCACTTGTCTTTTTTGTATTTTTTATTTTGTATTATTGAAAG
CCTTGGAGATCTCACAGATAGATATGCCAAATTCTATATTTTGTAAATTCTCTATATTAG
AAAACAGCTGTGCACAGCAGGGCGGGTGTGCTCATTTGTACTGTGTGTATGTCGGTGTAT
GTACTGGTGTATATGTGTGTGTGTTCATGCTGTGGAACTGGTCTCACACAGGATGTGTTT
CCCTCATTTCAGATTTGGCAGTTTTGGGTTTTCCAAGGTACCACCAGAGCAGTGGGTGTG
TGCTTTTGGGGTACCATATGCTCAGATTAAGTAGGAGGATGCATGGACACACTGCCCCAT
CTTTTCTGACACACGCACACGTATGTACACACATGCACACACCCTCCTTTCCCTAAGCAA
AACGCAGATGGAAATAAGAAAACAAAAAGCTGCTTTCCCATCCCAGGCCGAGCTGGAACC
AAGGGAAGCAATCTCATCCTGCGACAGGCAGTGTGGTGCCCTCCACACCCTGAGATTTCA
GACGTTTGCGGCTTACAGAGGCAGCGCCCACAGATTCCAGAGTGCTTACAGAAAGCCANG
TGCTTTGCAGGCTGGGACGAAGAAGCCAAGCTNCCTGCCTACTCATTGGCCAGGTGCANG
TGGCTCTTCTGAGATGTCACTCGACTGTGGATGCATGTGCACN
3' Read Nucleotide Sequence
>OriGene 3' read for AK098381 unedited
GTACAGCTATGNNACCGCGGCCGCAATCTAGNGATCGGTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACCCGGGAAAGGGTTTAATAGTTAAATTAT
TTAAATAGACTTTTCAATTTCCATGGGAAAACATAATCGTATCTGTTTTTGCAAGAGTAG
GAATAAAAAGAGTGCCCCCCCTTTAAAGGGAACCAAAAGCTAGCCCTGGCCCTGCACACT
GTCACCAATCACTGGTGGGATGGGAAAGGGGTCCCCATGGGGCCGGGAAGCCCTGACCCT
GGGAAAACATGGGATGAACTCAGCACACCCCCTTTACTCAGGTTGGAAGCAAAACGAAAA
CCCCACCCCCCTGGCGGGCGATGTGGAGGGGCAGGGAACTTGAAAACAACAGCTGGAAAA
AAGCAGGCCTCCTGTGGCCAACGTCAGGGTGGCAATGCCAAACTCAAAGGATGGAGCAGC
AAAAGCACGGGACAAACTCAGGCTTGGCAGTTTTGGGTCCACACACTTTGCTTCTCAAAA
CTGTGTTCAATTTGTGTGCCGGGAGGGGAGGGTGGTGCTAAAACCCAATGAGAGGTGGTA
CAGGTGGACATCAAAGTCACATTGTGGCAGCTGGCACAGAGCCACTGGCTCATCACCTCC
AAGCTCATGTTGGAGGTGAAGATCATTCTAACCTGAGAAGCAATGGAAAGATTTGGGCAT
GGGCCCTAAGGGATCCACTGAATTCTGTGCTAGAGTATCATTTTCCAAATGTCCTTCCTC
AAGGGTATAAAAAAAGGAATTTTTTCTTGGGATGGTTAACTGCCCCCTCCCACTAAACCA
AATTCTGCTAGCTTTCCCCGGGGACTCTAAAGCTGGGCTCTACCCCATCTCTGCCCGGGT
TGCCGGNTGAAGGTAAGGCCCCTCCCTTTTCGCAAAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN AK098381
ORF Size 1684 bp
Insert Size 2000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq Size 1684
RefSeq ORF 1684
Locus ID 111
Cytogenetics 3q21.1
Protein Families Transmembrane, Druggable Genome
Protein Pathways Purine metabolism, Chemokine signaling pathway, Oocyte meiosis, Vascular smooth muscle contraction, Gap junction, GnRH signaling pathway, Progesterone-mediated oocyte maturation, Melanogenesis, Dilated cardiomyopathy
Gene Summary This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.