(BC057363) Mouse Tagged ORF Clone

CAT#: MG200001

MGC:67274 (GFP-tagged) - Mouse cDNA clone MGC:67274 IMAGE:6821272

Change vector?

  • TrueORF®

USD 351


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name (BC057363) Mouse Tagged ORF Clone
Vector pCMV6-AC-GFP
Sequence Data
ORF Nucleotide Sequence
>MG200001 representing BC057363
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACTCCAGGCTCCCAGATTTTCAAGAACTGGACCTG

ACGCGTACGCGGCCGCTCGAG - GFP Tag - GTTTAA
Protein Sequence
>MG200001 representing BC057363
Red=Cloning site Green=Tags(s)

MDSRLPDFQELDL

TRTRRLE - GFP Tag - V
Restriction Sites SgfI-MluI      Cloning Scheme for this gene      Plasmid Map     
Tag TurboGFP
ACCN BC057363
ORF Size 39 bp
OTI Disclaimer The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene.
Product Components The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Reference Data
RefSeq BC057363.1
RefSeq Size 4562
RefSeq ORF 41
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.