Rfc2 (NM_020022) Mouse Untagged Clone

CAT#: MC205798

Rfc2 (untagged) - Mouse replication factor C (activator 1) 2 (Rfc2), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rfc2 (NM_020022) Mouse Untagged Clone
Symbol Rfc2
Synonyms 2610008M13Rik; 40kDa; AI326953; Recc2
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC023028
CGGGAAGAGCAGCCACCGGAATGGAGGTTCAGGAGAGTGGCTGTGACCCATCCGAGAGTGGGGCGCAGGA GCCCTCGCCTGTCCCCAGCAAGACCGCCGGCCACTACGAGCTGCCGTGGGTTGAAAAATACAGACCATTG AAGCTCAACGAAATAGTGGGCAATGAAGACACTGTGAGCAGGCTGGAGGTCTTTGCAAGAGAAGGCAATG TGCCCAATATCATCATTGCTGGTCCCCCAGGAACTGGCAAGACAACCAGCATCCTCTGCTTGGCTCGAGC CTTGCTGGGCCCCGCCCTGAAGGACGCAGTCCTGGAACTCAATGCCTCAAATGACAGGGGCATCGATGTG GTGAGGAATAAAATCAAAATGTTCGCCCAGCAGAAAGTCACCCTTCCCAAGGGCCGGCACAAGATCATCA TTCTAGATGAAGCAGACAGCATGACGGACGGTGCCCAGCAGGCCCTCAGGAGAACCATGGAAATCTACTC GAAGACGACCCGATTCGCTTTGGCGTGTAATGCTTCAGACAAAATCATAGAGCCCATCCAGTCCCGCTGT GCGGTGCTCCGCTACACCAAGCTCACTGACGCTCAGGTCCTCACCAGGCTCATGAATGTCATCGAGAAGG AAAAGGTGCCATACACAGATGACGGCCTGGAAGCCATTATCTTCACAGCCCAGGGAGACATGCGCCAGGC ACTGAACAACCTGCAGTCCACCTTCTCAGGATTTGGCTATATCAACAGTGAGAATGTATTCAAGGTCTGC GACGAGCCCCACCCCCTGCTGGTGAAGGAGATGATCCAGCACTGCGTGGACGCCAACATTGACGAGGCCT ATAAGATTCTTGCTCACCTGTGGCACCTGGGCTACTCACCAGAAGATGTCATCGGCAACATTTTCCGAGT CTGCAAAACCTTCCCGATGGCTGAATACTTGAAACTGGAGTTCATCAAGGAGATTGGATACACTCACATG AAAGTGGCGGAAGGAGTGAACTCCCTGCTGCAGATGGCTGGGCTCCTGGCCAGGCTGTGTCAGAAGACCA TGGCTCCAGTGGCCAGCTGACTTGAGACGGCCTCCACTGATGGAACTAGGAGAGTCTTTGTTGTGGGAGA TGTGCCTCAGCTAGAACATGCTCACTTTGTTTTTCTTCTGTGAAAATAGTCTCTTGTACCCCAGGCTGAC CTTGAACTCCCGATCCTGCCGAGTGCTGGGGTTGGAGGTGTGTGTCACGTGTGCTTTCTGCGGTACTACA GATGGAACCCAGGACTCGTGCGTGTCAGACGAGCACTGCCAGCTGGGCTACAGCGAGATACTGAGCTCTG GAAGTGACACACCTCTGCTCTTCTGTGTGAATTCAAGCCCTGGACATGGGGCATGCTGGGAAAGCTCTGA CCTCCTCAGTCTTGTAGCCGATAAAGCCTTTGGATGTTCAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_020022
ORF Size 1050 bp
Insert Size 1050
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC023028, NP_064406
RefSeq Size 1459
RefSeq ORF 1050
Locus ID 19718
Cytogenetics 5 G2|5 74.68 cM
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.