Retn (NM_022984) Mouse Untagged Clone

CAT#: MC204783

Retn (untagged) - Mouse resistin (Retn), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Retn
• Synonyms: ADSF; Fizz3; Rstn; Xcp4
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC051196
  GGCACGAGGCAGGAGCTAATACCCAGAACTGAGTTGTGTCCTGCTAAGTCCTCTGCCACGTACCCACGGG ATGAAGAACCTTTCATTTCCCCTCCTTTTCCTTTTCTTCCTTGTCCCTGAACTGCTGGGCTCCAGCATGC CACTGTGTCCCATCGATGAAGCCATCGACAAGAAGATCAAACAAGACTTCAACTCCCTGTTTCCAAATGC AATAAAGAACATTGGCTTAAATTGCTGGACAGTCTCCTCCAGAGGGAAGTTGGCCTCCTGCCCAGAAGGC ACAGCAGTCTTGAGCTGCTCCTGTGGCTCTGCCTGTGGCTCGTGGGACATTCGTGAAGAAAAAGTGTGTC ACTGCCAGTGTGCAAGGATAGACTGGACAGCAGCCCGCTGCTGTAAGCTGCAGGTCGCTTCCTGATGTCG GGGAAGTGAGCGTGGTTTCCAGCACAGCCACCCGTTCCTGTAGCTCCAGAGATGTCTGATGTCCTCCGGT CTCTACAGGCACCTGCACTCACGTGCGCGAATCCACACACAAGCACACATACTTAAAAATAAAACAAAAC AGGCTGGAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: EcoRI-NotI
• ACCN: NM_022984
• Insert Size: 345 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC051196, AAH51196
• RefSeq Size: 593 bp
• RefSeq ORF: 345 bp
• Locus ID: 57264
• UniProt ID: Q99P87
• Cytogenetics: 8 1.92 cM
• Gene Summary: Hormone that seems to suppress insulin ability to stimulate glucose uptake into adipose cells. Potentially links obesity to diabetes.[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longer transcript. Both variants 1 and 2 encode the same protein.