Orm1 (NM_008768) Mouse Untagged Clone
CAT#: MC204272
Orm1 (untagged) - Mouse orosomucoid 1 (Orm1), (10ug)
"NM_008768" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Orm1 |
Synonyms | Agp; Agp-1; Agp-2; Orm; Orm-1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC012725
CACGCGTCCGCAGGCCTGGTGGCTCTGAGTGCCCTCAGCATGGCGCTGCACACGGTTCTTATCATATTGA GCCTTCTGCCGATGTTGGAAGCTCAGAACCCAGAACATGCCAACTTCACCATAGGCGAACCTATCACCAA TGAGACCCTGAGCTGGCTCTCTGACAAATGGTTTTTCATGGGTGCAGCTTTCAGAAAACTCGAGTACAGG CAGGCAATTCAAACAATGCAGAGTGAATTTTTTTACCTTACCACCAACTTGATAAACGACACAATAGAGC TTCGGGAGTCTCAAACAATAGGTGACCAGTGTGTCTATAACTCCACCCATCTAGGATTCCAGAGAGAAAA TGGGACCTTCTCCAAGTATGAAGGAGGAGTAGAAACCTTTGCCCACCTTATAGTGCTGAGGAAACATGGG GCCTTCATGCTTGCCTTTGACCTCAAGGATGAGAAGAAACGGGGACTGTCCCTCTATGCCAAAAGGCCAG ATATCACCCCGGAGCTGCAGGAAGTATTCCAGAAGGCTGTCACACACGTGGGCATGGATGAATCAGAAAT CATATTTGTCGACTGGAAAAAGGATAGGTGCGGTCAGCAGGAGAAGAAGCAGCTTGAGTTGGGGAAGGAG ACCAAGAAAGATCCTGAGGAAGGCCAGGCATGAACTCAGCTCTCTGAACTCTGAGGGCTGTCCACAGGCT CACCAAACCCCACCCCCTCCTGTGCACTTTGATTCTGTCTCTGCAACAATAAAGGTTTGCTGAAACAGTT AAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008768 |
Insert Size | 624 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC012725, AAH12725 |
RefSeq Size | 785 bp |
RefSeq ORF | 624 bp |
Locus ID | 18405 |
UniProt ID | Q60590 |
Cytogenetics | 4 33.96 cM |
Gene Summary | This gene encodes a member of the lipocalin family of proteins. The encoded protein is an abundant acute-phase protein that is synthesized by hepatocytes in response to cytokines during the acute phase response. The encoded protein may regulate inflammation and metabolism. This gene is present in a gene cluster on chromosome 4. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202201 | Orm1 (tGFP-tagged) - Mouse orosomucoid 1 (Orm1) |
USD 500.00 |
|
MR202201 | Orm1 (Myc-DDK-tagged) - Mouse orosomucoid 1 (Orm1) |
USD 300.00 |
|
MR202201L3 | Lenti ORF clone of Orm1 (Myc-DDK-tagged) - Mouse orosomucoid 1 (Orm1) |
USD 600.00 |
|
MR202201L4 | Lenti ORF clone of Orm1 (mGFP-tagged) - Mouse orosomucoid 1 (Orm1) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review