Ak6 (NM_027592) Mouse Untagged Clone

CAT#: MC203915

Taf9 (untagged) - Mouse TAF9 RNA polymerase II, TATA box binding protein (TBP)-associated factor (Taf9), transcript variant 2, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ak6
• Synonyms: 2810046E22Rik; 4921516M08Rik; AK/ATPase
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC019453
  GCTTTGGCTGCAGGGGAAGGAGGACTATGAAGCTTCCGAATATCCTGCTCACCGGTACACCAGGGGTTGG AAAAACCACACTAGGCAAAGAACTTGCATCAAGATCAGGCCTGAAGTACGTTAACGTGGGAGATCTAGCT CGAGAAGGGCAGTTATACGACGGCTACGATGAGGAGTATGGCTGTCCCATTCTAGATGAGGATAGGGTTG TCGATGAGTTAGAGCATCAGATGCAGGAGGGCGGTGTGATTGTGGATTACCACGGCTGTGACTTCTTCCC CGAACGCTGGTTTCATATAGTGTTTGTGTTGAGAACAGATAATGGTGTATTGTATAAACGACTTGAAACA AGGGGTTATAATGAGAAGAAACTACAAGACAATATTCAGTGTGAGATTTTTCAAGTTCTTTATGAAGAAG CCATAGCATCTTACAAAGAAGAAATCGTGCATCAGCTGCCCAGTAATGAACCAGAACAGCTCGAGGACAA TATCAACCAAATCTCAAAATGGATTGAGCAGTGGGTCAAAGATCATAACCCTTAACTTAGACACTGGCTA GCCAGGCACCACCTCCGTCCATCGTCCCAGATCTTAGGAGGCAGCAGCTGGTCTACACAGTGAGTTCTAG GCCAGCCAGGGCTGCACAGTAAGGCTCTGTTTCAAAGGGAAAAAAGAAAAAGAAAAAAAGCCTGGCTACC GTCACTCAGTCCACATAGTAGGAACACGGGAGGATGAGCAGAAGAAAGCTTGTGTCGCAGCTCTAGCTGC TGCCTGGATTTCTTTTTCTCCGTGAGAAACCTTACACAATCTCAGATATGAATATAACTTATTAAAGATT AAAAGTTGTCTTCAAATTGAATTGATAATAAATCTGGTCAATGGAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_027592
• Insert Size: 519 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC019453, AAH19453
• RefSeq Size: 907 bp
• RefSeq ORF: 519 bp
• Locus ID: 102216272
• UniProt ID: Q8VCP8
• Cytogenetics: 13
• Gene Summary: Broad-specificity nucleoside monophosphate (NMP) kinase that catalyzes the reversible transfer of the terminal phosphate group between nucleoside triphosphates and monophosphates. May have a role in nuclear energy homeostasis. Has also ATPase activity. May be involved in regulation of Cajal body (CB) formation.[UniProtKB/Swiss-Prot Function]