Apoa5 (NM_080434) Mouse Untagged Clone

CAT#: MC203813

Apoa5 (untagged) - Mouse apolipoprotein A-V (Apoa5), (10ug)


  "NM_080434" in other vectors (4)

Reconstitution Protocol

USD 686.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Apoa5"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Apoa5
Synonyms 1300007O05Rik; Apoav; RAP3
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC011198
GGCAGCCTGAGTTCCAGGTTCCCTACTTTGTGACCGAGGGGCCATCGTGGAAAGCATGGCTGCAGTCATC ACTTGGGCCCTCGCCCTCCTCGCAGTGTTCGCAAGCACTCAGGCACGGAAGAGCCTCTGGGACTACTTCA GCCAAAACAGTTGGAGCAAAGGCGTGATGGGCCAGCCACAGAAGCTGGCACAGGAGAACCTGAAAGGCAG CTTCGAGCAAGACCTCTACAATATGAACAATTACCTAGAAAAGCTGGGACCCTTGAGAGGGCCTGGGAAG GAGCCTCCTCTGCTGGCCCAGGACCCAGAAGGCATTCGGAAACAGCTGCAGCAGGAGCTGGGGGAAGTGA GCTCGCGCCTGGAGCCCTACATGGCTGCGAAGCACCAGCAGGTAGGCTGGAACTTGGAGGGCCTGAGGCA GCAGTTGAAACCCTACACGGCGGAGCTGATGGAGCAGGTGGGCCTGAGTGTGCAGGAGCTGCAGGAGCAG CTGCGCGTGGTGGGAGAAGACACCAAGGCTCAGCTCCTGGGGGGCGTGGACGAGGCGCTGAACCTGCTAC AGGACATGCAGAGTCGAGTGCTGCACCAAGCCGACCGAGTCAAAGAGCTCTTCCACCCTTACGCAGAACG CTTGGTGACTGGAATTGGGCACCACGTGCAGGAGCTGCACCGCAGTGTCGCTCCTCACGCAGCTGCCAGC CCCGCGCGACTCAGTCGCTGCGTGCAGACTCTGTCCCACAAACTCACACGTAAGGCGAAGGACCTGCACA CCAGCATCCAACGCAACCTGGACCAGCTGCGCGATGAGCTCAGTGCCTTCATCCGCGTCAGCACAGATGG GGCGGAAGATGGAGATTCCCTGGACCCTCAGGCTCTCTCCGAGGAGCTCCGCCAGAGACTGCAGGCTTTT CGGCATGACACCTACCTGCAGATTGCTGCATTTACTCAGGCCATTGACCAGGAGACAGAGGAAATTCAGC ACCAGCTAGCCCCACCCCCGCCTAGCCACAGCGCCTTCGCTCCTGAGCTGGGACACTCAGACAGTAATAA GGCCCTGAGCAGACTGCAGAGCCGACTGGACGACCTGTGGGAAGATATTGCCTATGGCCTTCAAGACCAG GGTCATAGTCATTTGAGTGACCCTGAGGGTCACTCCGGTTAACCCTCCAGCTCATTGTCTGGACCCTGAG CCGCTAGCATGGTCTATTAGGCAGAGGGTGGAGGGTCCTGCACACCACCAAAGGTGCTGCTGTCCCAACC TACCCAGCCTCCTCAACTCCCCTACTCAGGGGCATTACACTCAGTAGGCTTTGCAAACCCAAAAAAAAAA AAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_080434
Insert Size 1107 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC011198, AAH11198
RefSeq Size 1341 bp
RefSeq ORF 1107 bp
Locus ID 66113
UniProt ID Q8C7G5
Cytogenetics 9 A5.2
Gene Summary Minor apolipoprotein mainly associated with HDL and to a lesser extent with VLDL. May also be associated with chylomicrons. Important determinant of plasma triglyceride (TG) levels by both being a potent stimulator of apo-CII lipoprotein lipase (LPL) TG hydrolysis and an inhibitor of the hepatic VLDL-TG production rate (without affecting the VLDL-apoB production rate). Activates poorly lecithin:cholesterol acyltransferase (LCAT) and does not enhance efflux of cholesterol from macrophages (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.