Selenos (NM_024439) Mouse Untagged Clone

CAT#: MC203796

Vimp (untagged) - Mouse histocompatibility 47 (H47), (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)


  "NM_024439" in other vectors (2)

Reconstitution Protocol

USD 242.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Selenos"

Specifications

Product Data
Type Mouse Untagged Clone
Symbol Selenos
Synonyms 1500011E07Rik; C78786; H-4; H-47; H4; H47; Se; Sels; Seps1; V; Vimp
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC011091
CGCAGAGCAGAGAGGAGCAGCGGGCTTGTCGTTGGTGGCGGTGGCGGTGGCCGCCATGGATCGCGATGAG GAACCTCTGTCTCCGAGGCCGGCGCTGGAGACCGAGAGCCTGCGATTCCTGCACGTGACAGTGGGCTCCC TGCTGGCCAGCTATGGCTGGTACATCCTCTTCAGCTGCATCCTACTCTACATTGTCATCCAGAGGCTCTC CCTTCGACTGAGGGCTTTGAGGCAGAGACAGCTGGACCAAGCCGAGACTGTTCTGGAACCTGATGTTGTT GTTAAGCGACAAGAGGCTTTAGCAGCTGCTCGTTTGAGAATGCAGGAAGATCTAAATGCCCAAGTTGAAA AACATAAGGAAAAACTAAGACAGCTTGAAGAAGAAAAAAGAAGACAGAAGATTGAAATGTGGGACAGCAT GCAAGAAGGCAGAAGTTACAAAAGAAATTCAGGAAGGCCTCAGGAAGAAGATGGTCCTGGACCTTCTACT TCATCTGTCATCCCCAAAGGAAAATCTGACAAAAAGCCTTTGCGAGGAGGTGGTTATAACCCTCTGACGG GTGAAGGGGGTGGAACCTGCTCCTGGAGACCTGGACGCAGGGGCCCATCATCTGGTGGATGAAACTAAGA CTCTTGTTAGTGTCGCTCTGACATTAGCAAGGTGAACCTTTAACCCTCAACTCAATTGCCTTACGCACAC TTTCACAGTGACTGGCCAAGGAGAGGTGGGGCTTTTCTCTGTTCTAAACTACTTGTACTTTAAGGGCTTT GGTCAGCATGAGATATAGACATTGCCATTAGGCCACACTCTAGACAAGACAGCCATGGCTTTCATGGCTG CTGGCTAGTTGGTAGGTTGAAGGCTTCTTGCTGTTTAGCAGACTTCATAAAGGAGGCCCAGTGATGATAC TTTGGGGTAGAAGTCCTTGCTGACAGGATGGTCTCTGTGACGGGATGCGTTGAATGATGTCTTCCTTATA AATGGTGAACCCACCAGTGAGGATTACTGATGTTCACAGTTGATGGGGTTTGCTTCTGTATATTTATTTT ATGTACAGAACTTTGTAAAAAAAAAAAGTTAAATACTTAAAAAGTAACATTTTTAGCATCTTTATTAAAC TCAAGGAAATTTCTTTGTGAGCTTGACTTTGTCAGACAGTAAACAGCTTTGTATCAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_024439
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC011091, AAH11091
RefSeq Size 1219 bp
Locus ID 109815
UniProt ID Q9BCZ4
Cytogenetics 7 35.49 cM
Gene Summary This gene encodes a transmembrane protein that is localized in the endoplasmic reticulum (ER). It is involved in the degradation process of misfolded proteins in the ER, and may also have a role in inflammation control. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Two additional phylogenetically conserved stem-loop structures (Stem-loop 1 and Stem-loop 2) in the 3' UTR of this mRNA have been shown to function as modulators of Sec insertion (PMID:23614019). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2017]
Transcript Variant: This variant (1) represents the predominant transcript and encodes the longer isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.