Exosc4 (NM_175399) Mouse Untagged Clone

CAT#: MC203787

Exosc4 (untagged) - Mouse exosome component 4 (Exosc4), (10ug)


  "NM_175399" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Exosc4"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Exosc4
Synonyms 1110039I09Rik; 1500001N04Rik; Rrp41
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012277
TCCAGGTCGAGCTGTCGGAGGCGGAGCCAGGACTGTACATCATGGCCGGGCTGGAGCTCCTGTCCGATCA GGGTTACCGGATAGACGGTCGCCGCGCGGGGGAGCTGCGCAAGATCCAGGCGCGGATGGGCGTGTTTGCG CAGGCCGATGGCTCGGCTTACATCGAGCAGGGAAACACCAAGGCACTGGCGGTGGTCTACGGGCCTCACG AGATCCGGGGCTCCCGGTCTCGAGCCCTGCCCGACCGGGCTCTAGTGAACTGTCAGTACAGTTCAGCCAC CTTCAGCACAGGTGAGCGCAAGCGAAGGCCTCATGGAGACCGGAAGTCTTGTGAGATGGGGCTGCAGCTA CGACAGACCTTCGAGGCAGCCATCCTCACACAGCTGCACCCCCGCTCTCAGATCGACATCTACGTGCAGG TGCTGCAAGCAGATGGTGGGACCTACGCAGCATGTGTGAATGCAGCCACGCTAGCAGTGATGGATGCTGG GATACCTATGCGGGACTTTGTATGCGCATGTTCAGCTGGCTTTGTGGATGGCACAGCACTAGCGGACCTC AGCCACGTGGAGGAAGCAGCTGGAGGGCCCCAGCTCGCCCTGGCCCTGCTGCCCGCCTCCGGCCAGATCG CACTGCTTGAGATGGACTCGAGGCTGCACGAAGACCACTTGGAGCAGGTGCTAGAGGCTGCTGCCCAGGC GGCCCGAGGTGTGCACACTCTGCTGGACCTTGTCGTCCGACAGCACGTGCAGGAGGCCTCTGTCTCACTG GGGGACTGAGTGGCAACCACCCGTTTCCAGAATAAAGGCCTGTTCTTCTCCCGAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_175399
Insert Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC012277, AAH12277
RefSeq Size 854 bp
RefSeq ORF 738 bp
Locus ID 109075
UniProt ID Q921I9
Cytogenetics 15 D3
Gene Summary Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. EXOSC4 binds to ARE-containing RNAs (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.