Fbxo2 (NM_176848) Mouse Untagged Clone

CAT#: MC203502

Fbxo2 (untagged) - Mouse F-box protein 2 (Fbxo2), (10ug)


  "NM_176848" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
Fbxo2 Antibody - C-terminal region
    • 100 ul

USD 539.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Fbxo2"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Fbxo2
Synonyms FBG1; Fbs1; Fbs2; FBX2; NFB42; Prpl4
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC046586
CTCTCTTGACAGCACCGCAGCGATGGATGGAGATGGTGATCCAGAGAGTGTGAGCCACCCCGAAGAAGCG AGCCCAGAGGAGCAGCCAGAGGAGGCGGGCGCCGAGGCGAGTGCGGAGGAGGAGCAGCTCCGGGAGGCGG AGGAGGAGGAAGAGGCGGAGGCCGTGGAGTACCTGGCCGAGCTGCCGGAGCCACTGCTGCTGCGCGTGCT GGCCGAGCTGCCAGCTACGGAGCTGGTGCAGGCCTGCCGCCTGGTGTGCCTGCGCTGGAAGGAGCTGGTG GACGGCGCCCCACTGTGGCTGCTCAAGTGCCAGCAGGAGGGGCTGGTGCCCGAGGGCAGCGCTGATGAGG AGCGGGACCACTGGCAACAGTTCTACTTTCTGAGCAAGAGGAGGCGCAACCTGCTGCGCAACCCTTGTGG GGAAGAGGACTTGGAGGGCTGGAGCGACGTGGAGCACGGTGGGGACGGCTGGAGGGTGGAGGAACTGCCC GGAGACAATGGGGTGGAATTTACCCAAGATGACAGCGTTAAGAAATACTTCGCCTCCTCCTTCGAGTGGT GTCGCAAAGCGCAGGTCATTGATCTGCAGGCAGAGGGCTACTGGGAGGAGCTACTGGACACCACCCAGCC CGCCATCGTGGTGAAGGACTGGTACTCGGGTCGCACTGATGCGGGCAGCCTGTATGAGCTCACTGTGAGG CTGCTGTCGGAGAACGAAGATGTGCTGGCGGAGTTCGCTACAGGACAGGTGGCTGTGCCAGAGGACGGCA GTTGGATGGAGATCTCCCACACCTTCATCGACTACGGGCCAGGTGTCCGCTTTGTCCGCTTCGAGCACGG AGGGCAGGACTCGGTCTACTGGAAGGGCTGGTTCGGGGCCCGGGTGACCAACAGTAGCGTGTGGGTGGAA CCCTGAACGACCTCCCCTACCCCCACCATCCGCCCTCTAAGGCAGAATTCTGGGGTAGAAAGGCCTTAAT TTAGTTGGTAGCATCCTCACCTGCCTCGCCCACGCCTTGCACCTGCCTCTCTCCCGCCCCTTCCTTCAGT CTGGTCCCGAGGAAAGAAGGACATGTTGCTTTACTGTAGGATGGCTTTCATTTGCATCTCCACGGGCAGT CGCTTCTAGAATGTACGATCCGAGGGGGTATGGGGCTGCTGCTGGATCCCGCGCTCCTAGCATTGTGCCT GCCTCAAAGTGGGCACTCAATAAATATTTGTCCAAAGAACGCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_176848
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC046586, AAH46586
RefSeq Size 1260 bp
RefSeq ORF 894 bp
Locus ID 230904
UniProt ID Q80UW2
Cytogenetics 4 78.68 cM
Gene Summary Substrate recognition component of a SCF (SKP1-CUL1-F-box protein) E3 ubiquitin-protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Involved in the endoplasmic reticulum-associated degradation pathway (ERAD) for misfolded lumenal proteins by recognizing and binding sugar chains on unfolded glycoproteins that are retrotranslocated into the cytosol and promoting their ubiquitination and subsequent degradation. Prevents formation of cytosolic aggregates of unfolded glycoproteins that have been retrotranslocated into the cytosol. Able to recognize and bind denatured glycoproteins, preferentially those of the high-mannose type.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.