Ube2d3 (NM_025356) Mouse Untagged Clone

CAT#: MC203282

Ube2d3 (untagged) - Mouse ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (Ube2d3), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ube2d3
• Synonyms: 1100001F19Rik; 9430029A22Rik; AA414951
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC057941
  CGCGTGAGCCCCGTAGGGCCGGGGAGGCACCAGCTGCCGCGCGGGGAGGAGGCCGAGGCCGCAGCTCGAG GGAGGCCCCGGCCCTCTGCGCCTGTGTCTGGCAGAGCCGGTGTGAGAAGAAGAGACAACCCTTCCCCGCC GCCGGGATAATCAAGAGTTTTGGCCGGACCTTTGAGTACACCTCGGGATAGTGAGGAGCCCGGCGAAAAG CACAGACTATGGCGCTGAAACGGATTAATAAGGAACTTAGTGATTTGGCCCGTGACCCTCCAGCACAATG TTCTGCAGGTCCAGTTGGAGATGACATGTTTCATTGGCAAGCCACAATTATGGGACCTAATGACAGCCCA TATCAAGGTGGTGTATTCTTTTTGACAATTCATTTTCCTACAGACTACCCCTTCAAACCACCTAAGGTTG CATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGCATTTGTCTTGATATTCTAAGATC ACAGTGGTCTCCTGCTTTAACTATTTCTAAAGTTCTTTTATCCATTTGTTCACTGCTATGTGATCCAAAC CCAGACGACCCCCTAGTGCCAGAGATTGCACGGATCTATAAAACAGACAGAGATAAGTACAACAGAATAT CTCGGGAATGGACTCAGAAGTATGCCATGTGATGCTACCTTACAGTCAGAATAACCTGCATTATAGCTGG AATAAACTTTAAATTACTGTTCCTTTTTTGATTTTCTTATCCGGCTGCTCCCCTATCAGACCTCATCTTT CTTAATTTTATTTTTTGTTTACCTCCCTCCATTCATTCACATGCTCATCTGAGAAGACTTAAGTTCTTCC AGCTTTGGACAATAACTGCTTTTAGAAACTGTAAAGTAGTTACACGAGAACAGTTGCCCAAGATTCAGAA ATTTTTTTAAAAACTGGAGCATGTGTATTATGTGGCCAATGTCTTCACTCTAACTTGGTTATGAGACTAA ACCAATCCTCACTGCTCTAACATGCTGAAGAAGCCATCTGAGGGGGAGGGAGATGGATGCTCAGCTGTCA CATCAAAGGAAGCAGCATTATTCTAGCAGCATCCGTTCTTGTTTAAACCTTCCACTGTTAGAGGTTTGAG GTTACATGATATACTTTATGCTCATAACTGATGTGGCTGGAGAATTGGTATTGAATTATAGCATCAGCAG AACAGAAAATGTGATGTATTTTATGCATGTCAATAAAGGAATGACCTGTTCTTGTTCTACAGAGAATGGA AATTGGAAGTCAAACACCCTTTGTATTCCAAAATAGGGTCTCAAAACATTTTGTAATTTTCATTTAAATT GTTAGGAGGCTTGGAGCTATTAGTTAATCTATCTTCCAATACTGTTTAATATAGCACTGAATAAATGATG CGAGTTGTCAATGGATGAGTGATCAACTAATAGCTCTCCTAGTAATTGATTTATTTTTCTTCAATAAAGT TGCATAAACCAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_025356
• Insert Size: 444 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC057941, AAH57941
• RefSeq Size: 1500 bp
• RefSeq ORF: 444 bp
• Locus ID: 66105
• UniProt ID: P61079
• Cytogenetics: 3 G3
• Gene Summary: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys-11'-, as well as 'Lys-48'-linked polyubiquitination. Cooperates with the E2 CDC34 and the SCF(FBXW11) E3 ligase complex for the polyubiquitination of NFKBIA leading to its subsequent proteasomal degradation. Acts as an initiator E2, priming the phosphorylated NFKBIA target at positions 'Lys-21' and/or 'Lys-22' with a monoubiquitin. Ubiquitin chain elongation is then performed by CDC34, building ubiquitin chains from the UBE2D3-primed NFKBIA-linked ubiquitin. Acts also as an initiator E2, in conjunction with RNF8, for the priming of PCNA. Monoubiquitination of PCNA, and its subsequent polyubiquitination, are essential events in the operation of the DNA damage tolerance (DDT) pathway that is activated after DNA damage caused by UV or chemical agents during S-phase. Associates with the BRCA1/BARD1 E3 ligase complex to perform ubiquitination at DNA damage sites following ionizing radiation leading to DNA repair. Targets DAPK3 for ubiquitination which influences promyelocytic leukemia protein nuclear body (PML-NB) formation in the nucleus. In conjunction with the MDM2 and TOPORS E3 ligases, functions ubiquitination of p53/TP53. Supports NRDP1-mediated ubiquitination and degradation of ERBB3 and of BRUCE which triggers apoptosis. In conjunction with the CBL E3 ligase, targets EGFR for polyubiquitination at the plasma membrane as well as during its internalization and transport on endosomes. In conjunction with the STUB1 E3 quality control E3 ligase, ubiquitinates unfolded proteins to catalyze their immediate destruction.[UniProtKB/Swiss-Prot Function]