Gnb1l (NM_023120) Mouse Untagged Clone

CAT#: MC203070

Gnb1l (untagged) - Mouse guanine nucleotide binding protein (G protein), beta polypeptide 1-like (Gnb1l), transcript variant 2, (10ug)

  View "NM_023120" in other vectors (6)

USD 200.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Gnb1l (NM_023120) Mouse Untagged Clone
Symbol Gnb1l
Synonyms ESTM55; Gm16314; Me49f07; OTTMUSG00000033458; Wdr14; Wdvcf
Vector pCMV6-Kan/Neo
Sequence Data
>BC037676
CCACGCGTCCGGTTCTCCAGCGGAGCCTCTGATCCTGGCGGCCCCTCCTGGCGCAGTCCTAGGACTGCAT TTACCCACATGGCAGCCCTGTTCCCACCACCGCCTGGTCCCAGATTTGTCCTCCGAGGCACACAGTCGGC TGTGAACACGCTCCATTTCTGCCCACCATCCCAAGCTGCAGGGAACCCACTTCTCTTCTCAGGGTCTCAG AATGGCCTAGTACATATCTGGAGCCTACAAACAAGAAGAATAGTTACCACTCTAAATGGCCATGGGGGCC AGGGTGTAATCTGGCTGAAGACACTGCCACAGGGACACCAGCTCCTCAGCCAGGGTCGAGACCTGCGGCT GTGCCTGTGGGACCTGGAGGAGGGCAGGAACACCATCATGGACTCAGTTCAGCTGGACAGTGTGGGCTTC TGCAGGGGCTCCATCCTGGTCAGGGGACAGCAGTGCTGGATGCTTGCTGTGCCAGGGAAGGGCAGCGACG AGGTTCAGATTCTGGAGATGCCATCCAAGACGTCAGTGTGCACCCTGAAGCCGGAGGCCGATGCCAGGCC AGGCATGCCCATGTGCCTGGGACTGTGGCAGACTAACTCCAGTCTCCGCCCCCTCCTTCTGGCTGGCTAT GAGGATGGATCAGTAACCCTGTGGGACATCTCAGAGCGGAAGGTGTGCAGCCAAATCACCTGCCATGAAG AGCCTGTCATGGGCCTCGACTTCGACTCTCAGAAGGCCAAGGGCATCTCTGGCTCTGCTGGGAAGGTACT GGCTGTCTGGAGTCTGGACGATCAGCAGTCCCTGCAGGTGAAGAAGACTCATGAACTCACCAATCCTGGA ATTGCCGAAGTCACCATCCGGCCAGACCACAAGATCTTAGCCACAGCAGGCTGGGACCATCGCATCCGTG TGTTTCACTGGAGGACAATGAAACCGTTAGCTGTTCTGGCTTTCCACAGCGCTCCTGTGTACTGCGTGGC CTTTGCTGCTGATGGCTTGCTTGCTGCGGGGTCCAAGGACCAGCGTATCAGCATCTGGTCACTCTACCCC TGCCCATGACTTAGCTGTGAGACACTGCTATTTTACTCCAGTCTTGACCCAGCCCTGTGGAAGATCTTCA AGTCCCTCTGAGGACAGCAAATTGTGGCCAAAGATCCCTGGGGTCCACTTTCTTCGTGAGGTTCTCTGTT CCTTTTGTGACTGTCATTCAGATGATAGACACCTGGCACCTATAGCTTGGTAACAGGCATGTTTTAGACC TGGTAGGGTGGCCAGACTAAAGATATTTGACAATAAATTTCCCATTGCCAACAAAAAAAAAAAAAAAAAA AAAAAA
Restriction Sites RsrII-NotI     
Tag Tag Free
ACCN NM_023120
ORF Size 981 bp
Insert Size 981
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC037676, NP_075609
RefSeq Size 1336
RefSeq ORF 981
Locus ID 13972
Cytogenetics 16 A3|16 11.46 cM

Other Versions

Other products for "Gnb1l"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies