Cdk2ap2 (NM_026373) Mouse Untagged Clone

CAT#: MC203038

Cdk2ap2 (untagged) - Mouse CDK2-associated protein 2 (Cdk2ap2), (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Cdk2ap2
• Synonyms: 5830466O21Rik; D19Ertd144e; Doc-1r
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC025656
  CCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGGTTGGGATGTCCTACAAACCTATCGCGCCCGCCCC CAGCAGTACCCCGGGCTCCAGCACCCCCGGGCCAGGCACCCCGGTCCCTACAGCCGGGAGTGTCCCATCG CCATCGGGCTCAGTGCCAGGAGCTGCCGCACCTTTCAGACCGCTGTTTAACGACTTTGGTCCGCCCTCCA TGGGGTATGTACAGGCGATGAAGCCACCTGGTTCCCAGGGCTCTCAGAGCACCTACACGGACCTGCTGTC TGTCATAGAGGAGATGGGCAAAGAGATCCGGCCCACCTATGCTGGTAGCAAGAGTGCCATGGAGCGCCTG AAGAGAGGCATCATCCACGCTCGGGCACTAGTCAGAGAGTGCTTGGCAGAGACAGAACGCAATGCCCGCA CGTAACAGGAAGCACCTTGACCTCCTCGCCGGGACCTTTCTGGCCACTGCAGAGCGCCTGCTTCTCCCTG GCCTTCGCGCCCCAAGTTGCTTCCTATCCTGGGCTTCCTGTCCTGTGTCCCTTAGTGGGCACCCTCCAGG AACCAGGTAGCAGATCTTCGTCCAGTTGGCTGTACAAACTGGTCTCCTCCCTCTGTGGGAGTGCTGGGAG GCCACTGGGAGTCCCTTCCATGACCTGCTCACAGTGCTGATCTGACGGGAGCTTGCTCCTCTCTGTGGCC CCACCACACAGCACTTACTCCTTAACTCTTAGCCCAGGCCACCTCCTGCCTCTTCAACAGGAGTGCAGAA GACCTTCCTGCCTCATCTCTGGGGCCACAGCCGACTCTTTTTTTGGTGTGTCTTTTACTAAATATGTCCT TTTTGTATAAATAAAAGATGCTTTGGAGTCATTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_026373
• Insert Size: 384 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC025656, AAH25656
• RefSeq Size: 924 bp
• RefSeq ORF: 384 bp
• Locus ID: 52004
• UniProt ID: Q9CPY4
• Cytogenetics: 19 A
• Gene Summary: Plays a role in regulating the self-renewal of embryonic stem cells (ESCs) and in maintaining cell survival during terminal differentiation of ESCs (PubMed:22548356). Regulates microtubule organization of metaphase II oocytes (PubMed:12944431). Inhibits cell cycle G1/S phase transition by repressing CDK2 expression and activation; represses CDK2 activation by inhibiting its interaction with cyclin E and A (By similarity).[UniProtKB/Swiss-Prot Function]