Cpsf6 (NM_001013391) Mouse Untagged Clone

CAT#: MC202653

Cpsf6 (untagged) - Mouse cleavage and polyadenylation specific factor 6 (Cpsf6), (10ug)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cpsf6 (NM_001013391) Mouse Untagged Clone
Symbol Cpsf6
Synonyms 4733401N12Rik; AI256641; CFIM; CFIM68; HPBRII-4; HPBRII-7
Vector pCMV6-Kan/Neo
Sequence Data
Fully Sequenced ORF
>BC068133 sequence for NM_001013391
GCGGGCCGACCTGCAGGAGGCGGCGGCGGCGGCGGCCGAGGCCGAGGGAAGATGGCGGACGGTGTGGACC ACATAGACATTTACGCGGATGTGGGTGAAGAGTTCAACCAGGAAGCAGAATATGGTGGACATGATCAGAT AGATTTGTATGATGATGTCATCTCTCCATCTGCAAATAATGGCGATGCCCCAGAAGATCGCGACTACATG GATACTCTTCCACCAACTGTTGGTGATGATGTGGGTAAAGGAGCCGCACCAAACGTTGTGTACACTTACA CTGGGAAGAGAATCGCATTGTATATTGGAAATCTAACATGGTGGACAACAGATGAGGACCTAACTGAGGC CGTTCATTCTTTGGGAGTAAATGATATTTTGGAGATAAAATTCTTTGAAAATCGGGCAAATGGACAATCA AAGGGATTTGCCCTTGTTGGTGTTGGATCTGAAGCATCTTCCAAAAAGTTAATGGATCTTTTGCCTAAAA GAGAACTTCATGGTCAGAGTCCTGTTGTAACTCCATGCAATAAGCAGTTCCTGAGTCAATTTGAAATGCA ATCCAGGAAAACTACACAGTCAGGACAGATGTCTGGGGAAGGGAAAGCCGGTCCTCCAGGAGGCGGTTCA CGCGCAGCGTTTCCTCAAGGTGGTAGAGGACGGGGCCGGTTTCCAGGGGCTGTTCCTGGTGGGGACAGAT TTCCTGGGCCAGCAGGACCAGGAGGGCCACCTCCACCTTTTCCAGCTGGACAAACTCCACCACGTCCACC TTTAGGCCCACCTGGCCCACCTGGTCCACCAGGTCCTCCACCTCCTGGTCAGGTTCTGCCACCTCCTCTA GCAGGACCTCCTAACCGAGGAGACCGCCCTCCACCACCAGTTCTTTTTCCTGGACAACCTTTTGGGCAGC CTCCGCTGGGTCCACTTCCTCCTGGGCCTCCACCTCCAGTTCCAGGCTACGGCCCCCCTCCAGGTCCACC GCCTCCACAGCAGGGACCACCTCCACCTCCAGGCCCCTTTCCACCTCGCCCACCAGGTCCACTAGGGCCT CCCCTCACACTTGCTCCTCCTCCACATCTTCCGGGACCACCTCCAGGTGCCCCGCCACCAGCTCCACATG TGAATCCTGCTTTTTTTCCTCCACCAACTAATAGTGGCATGCCAACATCAGATAGTCGAGGTCCACCACC AACAGACCCATATGGCCGACCTCCCCCATATGATAGGGGTGACTACGGTCCCCCTGGGAGGGAAATGGAT ACTGCAAGAACACCTCTGAGTGAAGCTGAGTTTGAAGAAATCATGAATAGAAATCGGGCAATCTCAAGCA GTGCTATTTCAAGAGCTGTGTCTGACGCTAGTGCTGGTGATTATGGGAGTGCTATTGAAACATTGGTAAC AGCAATTTCTTTAATTAAACAATCCAAAGTCTCTGCAGATGATCGTTGCAAAGTTCTTATTAGCTCTCTG CAGGATTGCCTTCATGGAATCGAGTCCAAGTCCTATGGGTCTGGATCCAGACGTGAACGATCAAGAGAAC GGGACCATAGTAGATCACGGGAAAAGAGTCGTCGCCATAAATCTCGGAGTAGAGATCGCCACGATGACTA TTACAGAGAGAGAAGCAGAGAACGAGAGAGACACCGGGATCGGGACCGCGACCGTGACCGAGAGCGTGAC CGAGAGCGAGAATACCGTCATCGTTAGAAGCTGAAGGAAGAGGAACACCTTCCAAGACAAAAGAGTCTTC TCGGGGGAAAAGTGACGCTTGTCCAGCAGTTTGCTTCTTGTGATTGAACTGAACCTGTAAGGCTTCATGG ATAAACTGAACAGGAATAGATCTGAATAAAGCAAATCTGCATAAATGGTAACCAGTAGCTCTACTTTTAT TTTTTATGTTGCTTAACTGTTTTATTTGAAGGAAACCTGTGTGATTTAAAAAGTTAATAGCTTTTGCAAC TTTATTACTGGTTATATATATTTGGCCATTATAATGTGCAAGCAATTGGAAAAAAGTCAAGTAAATGCTT GTTTTTATAGTAGTTTGTTCTTGTTAAAATGTTCCTATGATAATGTCTGTAAACAGCACCGATTTGATTA CACTAGATGTAGTGTTGTAATAAACTGTTTATGGGGCTGATGTGTAAAGCTGTTCACGTTATTTGATGTT TACACCTCAGGGAAAGGCTTGTGTTCAGCAATATCTAAAGATAATGTTACTATGACAACATTTTTACTGT CCTTTAAAAAGCATTGCAATAGCGTGTTTGGATATGCATCAATCTAATCTTGCGTTCAGTGAATTAAACA TGACTAATTAAGTGTCTATTGCCCTTGATTTTGATATTAGAATAGGTGACTACATGGGTATTTAATATTT CTATATTCTGCTTTTCTAGCTGTTTTTACCTAGTTAGCTTGTGATTTTGCTGAATGGTATGTAAACGTGT AAAAACTGAAATTTGACAGAGCAATCCAGTCAATGTGTTAGGGGTCAAAAAAATTGAAGGCTGTAACATT TTTGGTAAAAACTCATGTATTTGCTACAGTAGTGCAGCTTAATTACAACCCAGATATACTGAAATAATAA ATTGTGAACTGCTAGCATTTAAGATAGATTTTGATAATTCTGGTTTCATGCAGTAATTTACTGTTTGATG CTGATGGTGCCATAGGCAGTGTAATTATGGCTATACAGCAAGATGCGTAAAGAAAGCTCTAGTATTGTAC TTGATTCAGATTTCTGAAGGGTGTGATGTTTATTAACATTGGGCTGTATTGTTCAGTGTGAATAATGAAA ATTTATAATTACACTGTCTTCATGGCTCAAGGAATTGTGTGTGTATTCCTGTAACCTTGTTGATCTATGC TTGATTAGAGTTAATCAGCTGATTTTTTTTTCTTTTTTTTTCCTTTCTTTCATTTTTTTTTTTAAAAGAT CCAGCCTTAATAAAAGGTTGTATTAAAAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AA
Restriction Sites AscI-NotI     
Tag Tag Free
ACCN NM_001013391
ORF Size 1656 bp
Insert Size 1656
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq BC068133, NP_001013409
RefSeq Size 3012
RefSeq ORF 1656
Locus ID 432508
Cytogenetics 10|10 D2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.