Bphl (NM_026512) Mouse Untagged Clone

CAT#: MC202243

Bphl (untagged) - Mouse biphenyl hydrolase-like (serine hydrolase, breast epithelial mucin-associated antigen) (Bphl), (10ug)


  "NM_026512" in other vectors (4)

Reconstitution Protocol

USD 300.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Bphl"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Bphl
Synonyms 2010012D11Rik; 5730533B08Rik; AI115341
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC025162 sequence for NM_026512
GGAGCTTGTGCGACCTGGAGCTATGGCGACCGCAACAGTTCGCCCGGCGGCCCAGCGGTTGCGGCTGCTC CTCTCGCCCCTGAAATCCCGGATCTGCGTACCCCAGGCCGAACCCGTAGCCACCTTCGGCACTGCAGTAA CTTCTGCCAAGGTGGCTGTGAATGGCGTTCACCTGCATTACCAGCGCGTGGGAGAAGGGGAACATGCGAT CCTCCTGCTTCCTGGGATGTTGGGTAGCGGAAAGACCGATTTTGCACCTCAGCTTCAGAGCCTAAATAAG AAGCGCTTCACATTGGTGGCCTGGGACCCTCGAGGATATGGATATTCCAGACCCCCAGATCGAGATTTTC CACGGGATTTTTTTGAAAGGGATGCAAAGGATGCTGTTGACTTGATGAAGGCTCTACAGTTCAAGCAGGT CTCCCTCCTGGGCTGGAGTGATGGCGGCATAACTGCGCTCATCGCTGCTGCAAAGTACCCATCTTATATC CGCAAGATGGTGATCTGGGGAGCAAATGCCTATGTCACCGAGGAAGACAGCAGGATTTACCAGGGTATCC GAGATGTTTCTAAATGGAGTGAGAAGGCAAGGAAACCCCTGGAAGCCCTGTATGGATATGACTACCTTGC CAAAACCTGTGAGGACTGGGTGGATGGCATAAGCCAGTTTAAACAACTGCCAGAGGGTAACATCTGCCGG CACTTGCTGCCCCTGGTCCAGTGCCCTACCCTCATTGTGCATGGGGAGAAGGACCCATTGGTCCCCCGCT TTCATGCTGACTTCCTTCTCCAGCATGTGAAAGGGTCACGGTTGCATCTGATGCCAGAAGGCAAGCACAA CTTACACTTACGCTTTGCAGACGAATTCAACAGGTTGGTAGAAGACTTTCTACAGTGAAAGTCCAGGAGA CAGACCGCTGGTGTCCAGCAGATTCTGTGTTAAAAGATCATGTCATTGCCTGTTACCTGGATGCTCCAAA ATGCCTTCCCTTGCTTTTGGCCTCGGCTCACAGACAGGCCTGCCAGGCTTTCTATCTTCCCTGCAATGTG ACTCTATGCAAACAGGAAAAATAGCATACCGAAATCAGGTTATAGCTTCAATAGCTGAAGAAACATGAAC ATTTCCATTTTTAACATTAACTCTCTATCATCGTCTATGAGTAAGTTCTTACCATGATTTGTTTTCAAAT AAAATTTATGGGAAACATTAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026512
Insert Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC025162, AAH25162
RefSeq Size 1224 bp
RefSeq ORF 876 bp
Locus ID 68021
UniProt ID Q8R164
Cytogenetics 13 A3.3
Gene Summary Serine hydrolase that catalyzes the hydrolytic activation of amino acid ester prodrugs of nucleoside analogs such as valacyclovir and valganciclovir. Activates valacyclovir to acyclovir. May play a role in detoxification processes. It is a specific alpha-amino acid ester hydrolase that prefers small, hydrophobic, and aromatic side chains and does not have a stringent requirement for the leaving group other than preferring a primary alcohol (By similarity).[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.