Defb1 (NM_007843) Mouse Untagged Clone

CAT#: MC202150

Defb1 (untagged) - Mouse defensin beta 1 (Defb1), (10ug)


  "NM_007843" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Defb1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Defb1
Synonyms AW260221; BD-1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024380 sequence for NM_007843
CTACCTGGGAGTTTCACATCCTCTCTGCACTCTGGACCCTGGCTGCCACCACTATGAAAACTCATTACTT TCTCCTGGTGATGATATGTTTTCTTTTCTCCCAGATGGAGCCAGGTGTTGGCATTCTCACAAGTCTTGGA CGAAGAACAGATCAATACAAATGCCTTCAACATGGAGGATTCTGTCTCCGCTCCAGCTGCCCATCTAATA CCAAACTACAGGGAACCTGTAAACCAGATAAGCCCAACTGTTGTAAGAGCTGACAGTAGTTTGAAGAATG GACATAAAGGACGAGCGATGGATTGTAAAATTAGTGTTTTAATAAATGAAATGTTTTTGAAGTTTATTTA CATCATATCAAAATAAATTTTATTTCTCAGTTTAGAAGAGCAAATTTTTTTAAAAAGTATTGGGCTTAGA ACAAGAGGTGGGAAAATCCAGAACATCTGCCTGGTCCTGAGTAATGATGGTCACAATTTGAGTGATATCA CTTCTATGTAATTTTATCACCATGCAAGATGCATCCAGCACAGGAAGGTCACACGGAATGGAACAGAGAA CACGGTACACAGGCTTCCTGGGATATAAAAGAGAATGACTCTTCCACAGTCTTAGCAGTCAGTTCTATGA CACCCCATCTGCAACCTTAGCAATAGAAACTCCTTTATAACTGTAAGTTGTCCAACCAGATCGCATCCTC CATGGGTAATGTCTGGATTTCCTGGTACTTTTAAAAAAGATTCAGCCACAACTTTCAAATATAATTGTGT ATCACAAATCTGTGTTGGGACTTGGACATCTGTGATTCAGGTCTTTTTTGCTGTTGTGTCTGTAGACATG CATGAATGAATAAAAGCAATCATGACATCCAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007843
Insert Size 210 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC024380, AAH24380
RefSeq Size 896 bp
RefSeq ORF 210 bp
Locus ID 13214
UniProt ID P56386
Cytogenetics 8 10.35 cM
Gene Summary Has bactericidal activity. May act as a ligand for C-C chemokine receptor CCR6. Positively regulates the sperm motility and bactericidal activity in a CCR6-dependent manner. Binds to CCR6 and triggers Ca2+ mobilization in the sperm which is important for its motility.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.