Timm9 (NM_013896) Mouse Untagged Clone
CAT#: MC202143
Timm9 (untagged) - Mouse translocase of inner mitochondrial membrane 9 homolog (yeast) (Timm9), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)
"NM_013896" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Timm9 |
Synonyms | 2810011L15Rik; Tim10a; Timm10 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024370 sequence for NM_013896
CGCTCGCTCTGTGCTGACCCTCCGAGCTCTCACGCTACCTGCCCCGCAGCTCTTCAGCCCGGTCCCGGTG TCAGAGGCGAGATCCTGTGGCTAATTTCAGAGTGATAAAAATGAAGAGCCTTTAAAATGAGTTAGCTGCA GGGTGCGTGGTGTACCCCTCGGCTCCAGCATTCGTACTGGAAGGAGAGAACCGCCTCCCCAGCTGTCCTC CTGTCTGCATGTACACTAAGGTAAGAAATCCAGTCTCACTGAAGACAAGCAGAAGGCGGGGCACTTGCTT TTCCAGAGCAGAAAAGAAACTGATGCATCAGAAAAGGTGACTAATAAACATACTGAAAGAATATGGCTGC ACAGATACCGGAATCTGACCAGATAAAACAGTTTAAGGAGTTCCTGGGAACCTACAATAAACTTACAGAA ACCTGCTTTTTGGACTGTGTTAAAGACTTCACAACAAGAGAGGTGAAACCTGAAGAGGTGACCTGTTCAG AACATTGCTTACAGAAATATTTAAAAATGACACAGAGGATATCCGTGAGATTTCAGGAATATCACATTCA GCAGAATGAAGCCCTGGCAGCCAAAGCAGGCCTCCTGGGCCAGCCACGGTAGAGAGGTCCTGAGGCGGGG ACTTGCACTGAAAGATTGCCAGCAGCTGCTGCAGTCAGAACAAGGATTCACATGGTGGAGAATCCCCTGA CACAGCAGGAGCCGTGGTCCACCATCTGTCATGACTACCTGACCAATGGAAACCACCAGAGAAAAACACT GTTCACCAGAAAGAGTCAAAACAGAAGGCCTTCCTGTGCGGTAAAAATGGTAAGATGCGGTGGTGTTGAG GCCTTAAGATTCGTCTGCGTGGTCACCGTGATTGCAAAAATAAACCACTGTTCCTTTCTTTGTGACTGTT AATTTTAAAGCAAAATATGTGTCCAATCATGTATGAGATAGAAAAAGTTTATTACTAAAAGTAAATAAAT GAGTATCATTAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_013896 |
Insert Size | 270 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024370, AAH24370 |
RefSeq Size | 1007 bp |
RefSeq ORF | 270 bp |
Locus ID | 30056 |
UniProt ID | Q9WV98 |
Cytogenetics | 12 |
Gene Summary | Mitochondrial intermembrane chaperone that participates in the import and insertion of multi-pass transmembrane proteins into the mitochondrial inner membrane. May also be required for the transfer of beta-barrel precursors from the TOM complex to the sorting and assembly machinery (SAM complex) of the outer membrane. Acts as a chaperone-like protein that protects the hydrophobic precursors from aggregation and guide them through the mitochondrial intermembrane space (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) is the longest transcript. All variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200218 | Timm9 (tGFP-tagged) - Mouse translocase of inner mitochondrial membrane 9 homolog (yeast) (Timm9), transcript variant 1 |
USD 350.00 |
{0} Product Review(s)
Be the first one to submit a review