Nxt1 (NM_019761) Mouse Untagged Clone

CAT#: MC201578

Nxt1 (untagged) - Mouse NTF2-related export protein 1 (Nxt1), transcript variant 2, (10ug)


  "NM_019761" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Nxt1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Nxt1
Synonyms 1110001N02Rik
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC023672 sequence for NM_019761
CGGCGCGCGGGAAGCCAGTACCGGCGCTTAACCGTTCCTCGCCTCCTGGACGTCGGCTTCTCAGGCGGAG CCTCTGGGAGGAAGAGGAGAACAGGAGAGAAACTCTTTTGGCCCGGGACCGCGACCGGGGCGGAACCCGG GACCGAGTCGCCTTGGCGGCGCTGACCGAGATCGAGCAGTCCCTGGATCCCTAAGGAGGAGGCGCTCAGG CGGAGGCCTCTTGTCAGCAGAACCAGAGATGGCATCAGTAGATTTCAAGACCTATGTGGACCAGGCCTGC AGAGCTGCAGAGGAATTTGTCAATGTCTATTACACGACTATGGATAAGCGGCGTCGGCTGCTGTCCCGCC TGTACATGGGCACAGCCACTTTAGTATGGAATGGAAATGCTGTTTCAGGACAAGAATCCTTGAGTGAGTT TTTTGAGATGTTGCCTTCCAGTGAGTTCCAAATCAGCGTAGTAGACTGCCAGCCTGTCCATGATGACGCT ACACCAAGCCAGACCACCGTGCTTGTGGTCATCTGTGGAACAGTGAAGTTTGAAGGCAACAAACAGCGGG ACTTCAACCAGAACTTCATCTTGACTGCTCAGGCGTCACCCAGTAACACAGTGTGGAAGATAGCAAGTGA CTGCTTCCGGTTCCAGGACTGGGCCAGCTAGTGGGGGTGACCGAGGCATCTTAGCTTAAGCCCAGCTCTG CAGAGAAATGCCAGTCTCAAATCTCAGGATGTGGAGAACACAAGTTCATTTTTGTTGTCACAGCAGCACT GCAGACTGGATGTTCGACTCCCAGAATCCCCATTTCCTGGTTATATACTGGTTTGTCATAGTTGCCTTTT AAAAGTAGTAAACTTTCTATTTTTCTACTTACTCAGTAGAGACCCTGTTTCTGGAACTTGACAAATAAAT ATGTTGCTTTTCTGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019761
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC023672, AAH23672
RefSeq Size 965 bp
RefSeq ORF 423 bp
Locus ID 56488
UniProt ID Q9QZV9
Cytogenetics 2 G3
Gene Summary Stimulator of protein export for NES-containing proteins. Also plays a role in the nuclear export of U1 snRNA, tRNA, and mRNA. The NXF1-NXT1 heterodimer is involved in the export of HSP70 mRNA in conjunction with ALYREF/THOC4 and THOC5 (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.