Ly6h (NM_011837) Mouse Untagged Clone

CAT#: MC201354

Ly6h (untagged) - Mouse lymphocyte antigen 6 complex, locus H (Ly6h), transcript variant 1, (10ug)

Specifications

Product Data

• Type: Mouse Untagged Clone
• Tag: Tag Free
• Symbol: Ly6h
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC028758 sequence for NM_011837
  TCGCTCCCCGCGCCGTGCCCGCCGCTGAGCCCGGAGTGCGGACACCCCAGGGATGCCTGCGCCCCAGAGG ACCCCCGCCTGCAGCCCCCGCGCCTCTTTCAGGCCCTATCGGAGCATGCTGCCTGCAGCCATGAAGAGCC TCGGTCTGGCGCTGCTGGCCTTGCTTCTCTGCCCCTCGCCGGCCCATGGCCTGTGGTGCCAGGACTGCAC CCTGGCCAATTCCAGCCATTGCGCTCCGAAGCAGTGCCAGCCCACCGATACCGTTTGTGCCAGCGTGCGG ATCACCGACCCCAGCAGCAGCAGGAAGGATCATTCTGTGAACAAGATGTGTGCTTCCTCCTGCGACTTCG TTAAGCGGCACTTTTTCTCAGACTATCTGATGGGGTTCATTAACTCTGGGATCTTAAAAGTCGACGTGGA CTGCTGCGAGAAAGATTTGTGCAACGGGGCATCGGTCGCAGGACGCAGCCCCTGGGCCCTGGCTGGGGGG CTCCTGCTCAGCCTGGGGCCTGCTCTTCTCTGGGCTGGGCCCTAAGACCCCTCCCTCCCTCCTGCTGGGC TTTGGAGCTTGTCCCCTAAGCCTGTTGCTGCCCCTCCCCAGCCTGGCCTGGCTGGGGCTGGGACAGCAAG GGTTTGGCATCAAGGTCTGAGGCTCTCAACCTCCCTAGATGTGAGTGAGCCTTCTCCGTTTCTCCACCAG CTCCATATCCCAAGCAGCTGAATATCTCCAGGAGTCCAGACATCCTGGCAGGAAGCTGGGGTAGGGGGGA GGGGGAGGGCAAGGGACTGAGACCCTCCAGGTCTCCAAGGGGAGGGAGGTCAAGCCAGGGACAGCCCAAC AGCCTGGCCTGAGGGGCATTAACTACAGAGAAATAAAGTCACTTCTGAGTCTTGTGAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: EcoRI-NotI
• ACCN: NM_011837
• Insert Size: 483 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: BC028758, AAH28758
• RefSeq Size: 934 bp
• RefSeq ORF: 483 bp
• Locus ID: 23934
• UniProt ID: Q9WUC3
• Cytogenetics: 15 D3
• Gene Summary: Believed to act as modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro inhibits alpha-3:beta-4-containing nAChRs maximum response. In vitro inhibits alpha-3:beta-4-containing nAChRs maximum response (PubMed:26276394). May play a role in the intracellular trafficking of alpha-7-containing nAChRs and may inhibit their expression at the cell surface (PubMed:25716842). Seems to inhibit alpha-7/CHRNA7 signaling in hippocampal neurons (By similarity).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). CCDS Note: This CCDS represents the longer Ly6h isoform and is based on the 5' splice pattern of AK021002.1, BC028758.1 and AF127091.1. The 5'-most AUG is selected as the translation initiation codon, but a downstream AUG with a stronger Kozak signal also exists, and may also be used by this transcript. Use of the downstream start codon would result in a protein that is 21 aa shorter at the N-terminus. The downstream start codon is also used by alternative 5' end variants, as in the mRNA AK034884.1 and the ESTs BM943584.1, CX238172.1 and BY253811.1.