Lamtor1 (NM_025605) Mouse Untagged Clone

CAT#: MC201213

Lamtor1 (untagged) - Mouse RIKEN cDNA 2400001E08 gene (2400001E08Rik), (10ug)


  "NM_025605" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00

Other products for "Lamtor1"

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Symbol Lamtor1
Synonyms 2400001E08Rik; p18; Pdro
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC020142 sequence for NM_025605
CGGACGCGTGGGTCCTGACGGACGCCGTCCCTCCTCGGCGCCGCCTGAGCGCCCGGCCCGACCCCGCCAT GGGGTGCTGCTATAGCAGCGAAAACGAGGACTCGGACCAGGATCGGGAGGAGAGGAAGCTGCTGCTGGAC CCCAGTAGCACCCCTACCAAAGCCCTCAATGGAGCCGAGCCCAACTACCATAGCCTACCTTCAGCTCGCA CAGATGAGCAGGCCCTGCTTTCCTCCATCCTTGCCAAGACAGCTAGCAACATCATTGATGTGTCTGCCGC AGACTCCCAGGGCATGGAACAGCATGAGTACATGGACCGGGCAAGGCAGTACAGTACCCGCTTGGCTGTG CTTAGCAGCAGTCTGACCCATTGGAAGAAGCTGCCACCGTTGCCATCTCTCACCAGCCAGCCCCACCAAG TGCTGGCCAGTGAGCCTATCCCCTTCTCTGACTTGCAGCAGGTCTCCAGGATAGCTGCGTATGCCTATAG TGCACTTTCTCAGATCCGCGTGGATGCGAAAGAAGAGCTGGTTGTACAGTTTGGGATCCCATGAAGAGGG GCCCTAGGACAGCTCTTCCCTCGTCTTCACCCCGTCTCCACCCCACCTCTTCTGGCCCCCAGCCTCACTG TGGCTCTCTACAGTACCTAACCTGCTACTAATCACGGAGAAGAATGTGGAGGGAAAGAACAAGGCTGGAG GCCGGAGCAAGTGAGGACTAAGCAAGGGAAGGGAGGACCGATTGCCATCGGCCTTCATGCTCTGGTTAGG GTGAGGTTGGGGCCAAGAGGACAGGGCCTGGCAGATCTTCAGTCATTGGGAAGATGGAGATACCACTGTA GGGGTGACACCGGGAGACCTAGGAGATCCCTTCCTGCCCTCTTTCTCTTGGCCTCCGATTCACTCCTGTC CCCTTCCCTGACTTGGTGCTCACAGGCACCTCACTGGGGATTATGACCAGGGTCTAGACGAGCTTGAGTC TGAATTGAGTTTGTATTTCTAGCACCCTGGGTTTTTACATGTTTGCTCTTTTTGTTTTTGTTTGTCACCC CTCGATAAAGAAAGTATATTCAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_025605
Insert Size 486 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC020142, AAH20142
RefSeq Size 1090 bp
RefSeq ORF 486 bp
Locus ID 66508
UniProt ID Q9CQ22
Cytogenetics 7 E2
Gene Summary As part of the Ragulator complex it is involved in amino acid sensing and activation of mTORC1, a signaling complex promoting cell growth in response to growth factors, energy levels, and amino acids. Activated by amino acids through a mechanism involving the lysosomal V-ATPase, the Ragulator functions as a guanine nucleotide exchange factor activating the small GTPases Rag. Activated Ragulator and Rag GTPases function as a scaffold recruiting mTORC1 to lysosomes where it is in turn activated. LAMTOR1 is directly responsible for anchoring the Ragulator complex to membranes. Also required for late endosomes/lysosomes biogenesis it may regulate both the recycling of receptors through endosomes and the MAPK signaling pathway through recruitment of some of its components to late endosomes. May be involved in cholesterol homeostasis regulating LDL uptake and cholesterol release from late endosomes/lysosomes. May also play a role in RHOA activation.[UniProtKB/Swiss-Prot Function]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.