Atg3 (NM_026402) Mouse Untagged Clone
CAT#: MC201069
Atg3 (untagged) - Mouse autophagy-related 3 (yeast) (Atg3), (10ug)
"NM_026402" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Symbol | Atg3 |
Synonyms | 2610016C12Rik; APG3; Apg3l; Atg3l; PC3-96 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010809 sequence for NM_026402
CGGACGCGTGGGCCGGGAAGAGAGACAGCTTGGAGAAGGCCGGGGGCTGCGCGCGCACCCGCCTCTCGCT CAGCCGGCTTGGGGCCTCTGCGGTGGCGGCCAGGTGACAGCTGGGCCGGGCCTCCGCGTGTCGCCGCCCC TCCCCCCCGGCCGGGCCGGTGCCGCTGCGAGGTTCGATGCCAGTCGGGCACGTCCGGGGCAGTTTTTGAC TCCCCTGTGGCCCGGATTGCGACAGTCCCTCCGTGCCCTATCGCTGCTCCAGCCCCAGGATGCAGAATGT GATCAACACGGTGAAGGGAAAGGCTCTGGAAGTGGCCGAGTACCTGACCCCGGTCCTCAAGGAATCAAAA TTTAAGGAAACGGGTGTAATCACTCCAGAAGAGTTTGTGGCAGCTGGAGATCACTTAGTCCACCACTGTC CAACATGGCAATGGGCTACAGGGGAAGAATTGAAAGTGAAGGCATATCTTCCGACAGACAAACAATTTTT GGTAACCAAAAATGTTCCATGCTACAAGCGGTGTAAACAGATGGAGTATTCGGATGAATTGGAAGCTATC ATTGAAGAAGATGATGGTGATGGGGGATGGGTAGATACATATCACAACACAGGTATTACAGGAATTACTG AAGCAGTTAAGGAGATTACACTGGAAAGCAAGGACAGTATAAAACTCCAAGATTGCTCAGCACTGTGTGA TGAAGAAGACGAGGAAGATGAAGGGGAAGCTGCAGACATGGAAGAATATGAAGAGAGTGGATTGTTGGAA ACAGATGAGGCTACCCTAGACACAAGGAAAATAGTGGAAGCCTGCAAAGCTAAGGCTGACGCTGGAGGTG AAGATGCTATTTTACAAACGAGAACATACGATCTGTACATCACTTACGACAAATATTACCAGACACCACG GCTATGGTTGTTTGGCTATGATGAGCAACGGCAGCCTTTAACAGTTGAGCACATGTATGAAGACATCAGT CAAGATCATGTGAAGAAAACAGTGACCATTGAAAACCATCCTCATCTCCCACCACCTCCTATGTGTTCAG TTCACCCATGCAGGCATGCTGAAGTGATGAAGAAAATTATTGAGACAGTTGCAGAAGGCGGGGGAGAGCT TGGTGTTCATATGTATCTTTTAATTTTTTTGAAATTTGTTCAAGCTGTCATTCCAACAATAGAATATGAC TACACAAGACACTTCACAATGTAGTGGAGAGGCTATAGAGTCTATCCTAATTACTGCTTCTGATTTTTAA AGAATTAATACATAGCTGTGACCATTGACCATATTTACCAATAAGAATAATTTCTCTAATAATGGGATTA TATGTTTATGCATTAAATAAAAACTGTTCTACTACCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026402 |
Insert Size | 945 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010809, AAH10809 |
RefSeq Size | 1381 bp |
RefSeq ORF | 945 bp |
Locus ID | 67841 |
UniProt ID | Q9CPX6 |
Cytogenetics | 16 B5 |
Gene Summary | E2 conjugating enzyme required for the cytoplasm to vacuole transport (Cvt), autophagy, and mitochondrial homeostasis. Responsible for the E2-like covalent binding of phosphatidylethanolamine to the C-terminal Gly of ATG8-like proteins (GABARAP, GABARAPL1, GABARAPL2 or MAP1LC3A). The ATG12-ATG5 conjugate plays a role of an E3 and promotes the transfer of ATG8-like proteins from ATG3 to phosphatidylethanolamine (PE). This step is required for the membrane association of ATG8-like proteins. The formation of the ATG8-phosphatidylethanolamine conjugates is essential for autophagy and for the cytoplasm to vacuole transport (Cvt). Preferred substrate is MAP1LC3A. Also acts as an autocatalytic E2-like enzyme, catalyzing the conjugation of ATG12 to itself, ATG12 conjugation to ATG3 playing a role in mitochondrial homeostasis but not in autophagy. ATG7 (E1-like enzyme) facilitates this reaction by forming an E1-E2 complex with ATG3. ATG12-ATG3 conjugate is also formed upon viccina virus infection, leading to the disruption the cellular autophagy which is not necessary for vaccinia survival and proliferation. Promotes primary ciliogenesis by removing OFD1 from centriolar satellites via the autophagic pathway.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204475 | Atg3 (tGFP-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
USD 500.00 |
|
MR204475 | Atg3 (Myc-DDK-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
USD 300.00 |
|
MR204475L3 | Lenti ORF clone of Atg3 (Myc-DDK-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
USD 600.00 |
|
MR204475L4 | Lenti ORF clone of Atg3 (mGFP-tagged) - Mouse autophagy-related 3 (yeast) (Atg3) |
USD 600.00 |
{0} Product Review(s)
Be the first one to submit a review