FOXP2 (NM_014491) Human 3' UTR Clone

CAT#: SC212500

3' UTR clone of forkhead box P2 (FOXP2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "FOXP2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol FOXP2
Synonyms CAGH44; SPCH1; TNRC10
ACCN NM_014491
Insert Size 1140 bp
Sequence Data
>SC212500 3' UTR clone of NM_014491
The sequence shown below is from the reference sequence of NM_014491. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AAGAGCCTTTATCTGAAGATCTGGAATGAGAACTGACTTGTGAAACCTCAGCGTGAAGGGACATATCACT
GACCTTCATAACCACTCCACAACCATGAATATTTGACAAATTTTTACTGTGACTATTTATTAAGCATGGA
TAAAGGAGACAGCCCTAAAGGAACTTACTAAGCCAGCCCTTTGGGATTCAGTACCAACAGGCAAATTGCT
TGTTTTCTTCTTCTTCTTCTTCTTTTTTTTTTTTTTTTTAGAAAAAAAGACAAAAACTGATTTTCTTGAA
AAAAAAAAATGAACTGTTCTTTCTATAATGGCTTTGCCCATTTAAAAAATGTGGCTCTTAAGGGTTCATG
AAATGACTGAATATGAGGATACATGTCCTGTAGAAAGCAAATGCGCCTCATATACTGCCAAAAATAGTGT
TAGTTTCATTAATGTGAATTTTCCAGCATTCAGTAGTTGTAATGTTAGAAACAATTGCTGGTCAAGTTCA
ACTTGTTGCTATTGTTTTTAATTTGCACAGGAGTAGTATCAGAAATTAGTGTCACTGCTTGTATCTAGCT
GAATTTTAAACAACAGAACATTAGTTTTTTATGTTGGTGCCACCAACTGTAAATGACATAAGTTAGTTAT
TACAAAACACAGTAATTAGACTGTTGCAACCATCTAAAACCTTAGGCTTCCAGTCTGTGCTGTTAGTGTT
AAGATGTAAAGTGCAATCCTAAGCTAACATTATCTGTGCAAGCACCATAGAAACATTTGCATATCTGCAT
AGATCTTACAACTGTACTCTTTACCTCCTTGTGATAAAGCTTTGTCTACCTGCAAACACAGTCAAAGGCT
ACAGCTGCAAACCAAAGCCAACTCTAACCATGGCCAAGAGCTCAAGGACAGAAGCAGCCACATGCTTTGG
TCAGCCTTCTGTAACTTCAATTAGTACAAAGGAACCTTTTCCATGAACTACCTGCTGTTTTCTGATGACC
TCTGGGATCTTTTCATTTAGCCCTAAACAAAGAAACAAATATGACAAAAACCACAACTAAAAAATGTTAA
TTCAGTCACAGAGTAATCTTCTGAGGCCAAAAGTCCATCTAAATGCAATGAAGATTTGCTTTCATTAAAG
ACAGAGGTGAGGACAAAATC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_014491.2
Summary This gene encodes a member of the forkhead/winged-helix (FOX) family of transcription factors. It is expressed in fetal and adult brain as well as in several other organs such as the lung and gut. The protein product contains a FOX DNA-binding domain and a large polyglutamine tract and is an evolutionarily conserved transcription factor, which may bind directly to approximately 300 to 400 gene promoters in the human genome to regulate the expression of a variety of genes. This gene is required for proper development of speech and language regions of the brain during embryogenesis, and may be involved in a variety of biological pathways and cascades that may ultimately influence language development. Mutations in this gene cause speech-language disorder 1 (SPCH1), also known as autosomal dominant speech and language disorder with orofacial dyspraxia. Multiple alternative transcripts encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Locus ID 93986

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.