ABCA8 (NM_007168) Human 3' UTR Clone

CAT#: SC210092

3' UTR clone of ATP-binding cassette sub-family A (ABC1) member 8 (ABCA8) for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "ABCA8"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ABCA8
ACCN NM_007168
Insert Size 826 bp
Sequence Data
>SC210092 3’UTR clone of NM_007168
The sequence shown below is from the reference sequence of NM_007168. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGAAGCTCCTCCCCCAGGAAGAGCCTTAAAACCCCAAATTCTGTGTTCCTGTTTAAACCCGTGGTTTT
TTTTAAATACATTTATTTTTATAGCAGCAATGTTCTATTTTTAGAAACTATATTATAAGTACAGAAATG
GTTCTCCGTGTGGTGGGAGGAGGAGGTTCGGGTGCTGGGTAAGTGCCATGTCAGTGTGGACAGAGGCAT
TTGACTAAGCCAACCTCCTCTCACAGCCTCTGTATCTCTGCAGGCCATACTGGTTCCATTGTTCTGTAT
AATACTGAATAAATAAATTTACTTTTACATGATCGTATAAGTTTCTAGATAAGATAAACAAATTTTGTT
TAAATTTTTTTAATAAAAATCTTAAAACACTTTTTTTCTAACCTAGACTGAGAAATTCATGTTTACTTT
TCTAGGTGTATGATACTTTGTAAAGTTGATACTTTCCTAAGAATTTAACATGTCATATTTTTGAAATAG
ATTTAAGTGTGCTTCTTATTGCTAAAAATACTAAATGTCATGGGTCATAGTATCTGATATCAATATCGT
TGATAACATATCCACAGGTAACACCATGATGTAGGCATAAATGGAAAACAAAAACCCTACTATTTCAAA
TATATTGTACTTTTTTATTTCTGTAAGCCAACTGTGTGCCATTTTCACTGGACTTTTAAATCTAGACTT
TAGTGATGTCTACATTGTAAATGATCTTTTGTGGATATTTGTCACTTGGTTTCAGAAAGTTCACAAATG
TAGCAACAGCTCACATGACTGAGTAGGTAGAAAATGTGAAATAAATCTCATATATATAGTTTTGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_007168.4
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Locus ID 10351
MW 32.2

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.