HLADQA1 (HLA-DQA1) (NM_002122) Human 3' UTR Clone

CAT#: SC209262

3' UTR clone of major histocompatibility complex class II DQ alpha 1 (HLA-DQA1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-DQA1
• Synonyms: CELIAC1; DQ-A1; DQA1; HLA-DQA
• ACCN: NM_002122
• Insert Size: 783 bp
• Sequence Data:
  Insert Sequence

  >SC209262 3’UTR clone of NM_002122
  The sequence shown below is from the reference sequence of NM_002122. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GGTGCTTCCAGACACCAAGGGCCATTGTGAATCCCATCCTGGAAGGGAAGGTGCATCGCCATCTACAGG
  AGCAGAAGAATGGACTTGCTAAATGACCTAGCACTATTCTCTGGCCCGATTTATCATATCCCTTTTCTC
  CTCCAAATATTTCTCCTCTCACCTTTTCTCTGGGACTTAAGCTGCTATATCCCCTCAGAGCTCACAAAT
  GCCTTTACATTCTTTCCCTGACCTCCTGATTTTTTTTTTCTTTTCTCAAATGTTACCTACAAAGACATG
  CCTGGGGTAAGCCACCCGGCTACCTAATTCCTCAGTAACCTCCATCTAAAATCTCCAAGGAAGCAATAA
  ATTCCTTTTATGAGATCTATGTCAAATTTTTCCATCTTTCATCCAGGGCTGACTGAAACTATGGCTAAT
  AATTGGGGTACTCTTATGTTTCAATCCAATTTAACCTCATTTCCCAGATCATTTTTCATGTCCAGTAAC
  ACAGAAGCCACCAAGTACAGTATAGCCTGATAATATGTTGATTTCTTAGCTGACATTAATATTTCTTGC
  TTCCTTGTGTTCCCACCCTTGGCACTGCCACCCACCCCTCAATTCAGGCAACAATGAAATTAATGGATA
  CCGTCTGCCCTTGGCCCAGAATTGTTATAGCAAAAATTTTAGAACCAAAAAATAAGTCTGTACTAATTT
  CAATGTGGCTTTTAAAAGTATGACAGAGAAATAAGTTAGGATAAAGGAAATTTGAATCTCAAAAATATC
  AAAAGTAAAAATGTATTCTCAAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002122.5
• Summary: HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]
• Locus ID: 3117
• MW: 30.1