JUND (NM_005354) Human 3' UTR Clone

CAT#: SC209153

3`UTR clone of jun D proto-oncogene (JUND) for miRNA target validation

Need custom modification / cloning service?
Get a free quote

USD 526.00


Availability*
5 Days

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name JUND (NM_005354) Human 3' UTR Clone
Vector pMirTarget
Symbol JUND
Synonyms AP-1
ACCN NM_005354
Insert Size 700
Sequence Data
>SC209153 3'UTR clone of NM_005354
The sequence shown below is from the reference sequence of NM_005354. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGTGCCCGCGTACTGAGTCCGCGCGCGGGGCGCATGCGCGGCCACCCTCCCCAAGGGGCGGGCTCGCGG
GGGGGTGTCGTGGGCGCCCCGGACTTGGAGAGGGTGCGGCCCTGGGGACCCCCCCCTCCCCGAGTGTGCC
CAGGAACTCAGAGAGGGCGCGGCCCCCGGGGATTCCCCCCCGAGGGTGCCCAGGACTCGGAAGGGGCGCC
CCGGACTCGACAAGCTGGACCCCCTGCTCCCGGGGGGGCGAGCGCATGACCCCCCCGCCCTCGCGCTGCC
TCTTTCCCCCGCGCGGCCGCCCCGTGTTGCACAAACCCGCGCGTCTCGGCTGCCCCTTTGTACACCGCGC
CGCGGAAGGGGGCTCCGAGGGGGCGCAGCCTCAAACCCTGCCTTTCCTTTACTTTTACTTTTTTTTTTTT
TCCTTTGGAAGAGAGAAGAACAGAGTGTTCGATTCTGCCCTATTTATGTTTCTACTCGGGAACAAACGTT
GGTTGTGTGTGTGTGTGTTTTCTTGTGTTGGTTTTTTAAAGAAATGGGAAGAAGAAAAAAAAATTCTCCG
CCCCTTTCCTCGATCTCGCTCCCCCCTTCGGTTCTTTCGACCGGTCCCCCCTCCCTTTTTTGTTCTGTTT
TGTTTTGTTTTGCTACGAGTCCACATTCCTGTTTGTAATCCTTGGTTCGCCCGGTTTTCTGTTTTCAGTA
AAGTCTCGTTACGCCAGC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_005354.4
Synonyms AP-1
Summary The protein encoded by this intronless gene is a member of the JUN family, and a functional component of the AP1 transcription factor complex. This protein has been proposed to protect cells from p53-dependent senescence and apoptosis. Alternative translation initiation site usage results in the production of different isoforms (PMID:12105216). [provided by RefSeq, Nov 2013]
Locus ID 3727
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents