Aminoadipate aminotransferase (AADAT) (NM_016228) Human 3' UTR Clone

CAT#: SC209125

3' UTR clone of aminoadipate aminotransferase (AADAT) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "AADAT"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol AADAT
Synonyms KAT2; KATII; KYAT2
ACCN NM_016228
Insert Size 736 bp
Sequence Data
>SC209125 3’UTR clone of NM_016228
The sequence shown below is from the reference sequence of NM_016228. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTAGCACAACTTATAAAAGAATCTTTATGAAGAAATTAAACTAGGTTGGGCATGGTGGCTCACACCTAT
AATCCCAGCACTTTGGGAGGCAGAGGAGGGAGGATCACTTGAACCCAGGAATTCAAGGCTGCAGTAAGC
TACGATCACACCACTGCACTCTGGCCTGCATGCACTCTGGCCTGCATGGCAGAACAAGACCCTGTCTCT
AAAAAAAGAGAAAGAAATCAAACTAATCATGCTGCTCATGGATTTTTCCAATAAATTTCTTGTTTTGGC
AGGAAGAAATGAACACTGGTATTAGACTTAAAGATTAAATTTCCTCAAACATGTCCTATCTGTAGTAGT
TCAACTAGACACCTTTTAAAGTGCCTCTAAATTCATCAGATGGCCAAACTGTATTTATAATCCACTTAG
GCATTTTGAAAAACTTTCAACCTGTAAAAAGTTACTTTTATCTTGGATTTATTATGAAGAACTTTGTAG
TTGCTTTGTAATTTCCCATAAATTGTCTTTGAAACTAACATTTTACACTGAATTATTTTGAGATTTTAA
AGAAGTAATTAAGTGCAAAATGGTATATAATGTGTACTTTTTCTACTTTTAGGAAAATTTAATGAGAGC
TTATTGCAAAAATTGTTATAATTTGGTCATTATAAGTGACTTTTAGTAAAAGTACCATAAACCTTATGT
TATGCCACAGAAATTCCTTTAAAATAAAATTCTTAAACTAAACATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_016228.4
Summary This gene encodes a protein that is highly similar to mouse and rat kynurenine aminotransferase II. The rat protein is a homodimer with two transaminase activities. One activity is the transamination of alpha-aminoadipic acid, a final step in the saccaropine pathway which is the major pathway for L-lysine catabolism. The other activity involves the transamination of kynurenine to produce kynurenine acid, the precursor of kynurenic acid which has neuroprotective properties. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Locus ID 51166
MW 27.9

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.