HMGB2 (NM_001130689) Human 3' UTR Clone

CAT#: SC209104

3' UTR clone of high-mobility group box 2 (HMGB2) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "HMGB2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HMGB2
Synonyms HMG2
ACCN NM_001130689
Insert Size 734 bp
Sequence Data
>SC209104 3’UTR clone of NM_001130689
The sequence shown below is from the reference sequence of NM_001130689. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGGAAGAGGATGAAGATGAAGAATAAATGGCTATCCTTTAATGATGCGTGTGGAATGTGTGTGTG
TGCTCAGGCAATTATTTTGCTAAGAATGTGAATTCAAGTGCAGCTCAATACTAGCTTCAGTATAAAAAC
TGTACAGATTTTTGTATAGCTGATAAGATTCTCTGTAGAGAAAATACTTTTAAAAAATGCAGGTTGTAG
CTTTTTGATGGGCTACTCATACAGTTAGATTTTACAGCTTCTGATGTTGAATGTTCCTAAATATTTAAT
GGTTTTTTTAATTTCTTGTGTATGGTAGCACAGCAAACTTGTAGGAATTAGTATCAATAGTAAATTTTG
GGTTTTTTAGGATGTTGCATTTCGTTTTTTTAAAAAAAATTTTGTAATAAAATTATGTATATTATTTCT
ATTGTCTTTGTCTTAATATGCTAAGTTAATTTTCACTTTAAAAAAGCCATTTGAAGACCAGAGCTATGT
TGATTTTTTTCGGTATTTCTGCCTAGTAGTTCTTAGACACAGTTGACCTAGTAAAATGTTTGAGAATTA
AAACCAAACATGCTCATATTTGCAAAATGTTCTTTAAAAGTTACATGTTGAACTCAGTGAACTTTATAA
GAATTTATGCAGTTTTACAGAACGTTAAGTTTTGTACTTGACGTTTCTGTTTATTAGCTAAATTGTTCC
TCAGGTGTGTGTATATATATATACATATATATATATATATATAT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001130689.1
Summary This gene encodes a member of the non-histone chromosomal high mobility group protein family. The proteins of this family are chromatin-associated and ubiquitously distributed in the nucleus of higher eukaryotic cells. In vitro studies have demonstrated that this protein is able to efficiently bend DNA and form DNA circles. These studies suggest a role in facilitating cooperative interactions between cis-acting proteins by promoting DNA flexibility. This protein was also reported to be involved in the final ligation step in DNA end-joining processes of DNA double-strand breaks repair and V(D)J recombination. [provided by RefSeq, Jul 2008]
Locus ID 3148
MW 28.4

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.