PACE4 (PCSK6) (NM_138322) Human 3' UTR Clone

CAT#: SC207043

3' UTR clone of proprotein convertase subtilisin/kexin type 6 (PCSK6) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "PCSK6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol PCSK6
Synonyms PACE4; SPC4
ACCN NM_138322
Insert Size 578 bp
Sequence Data
>SC207043 3’UTR clone of NM_138322
The sequence shown below is from the reference sequence of NM_138322. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGACCATTGGGTGGCCCTGGAATGTGTAGGAAGGGGTGTCATGAATTCCTTAAAAGGACTCTCCAAAT
AGCATTAGTTGTTATTATTAATTGTGTGTCACAAGAATTTAAAACGCATGTGCAGCTATTTAAGAAAAG
TATCCCGGAAGCTCACAGTGACATTACGGAAGAACCCTCAGGTCACAAGAGTCTGGGGTCTCCTATACT
CTATAACTTTGGCCACACCGAGACACCACCTATACCAATATTTACTCATAGTTCTCTTTAAGCCAGGAG
CAATGACGTGTGCCTATAGTCGCAGCTACTAGGGAAGTTGAGGCAGGAGGATTGCTTGAGCCCAGGAAT
TTGAGTCTAGCCTGGACAACACAGCAGGACTCCATCTCTTAAAAAAAAAATTACTTCCCCCACTACTTT
TTTTTGACATAAAAAAATGTATTTTAAAAGGAAACTGTACTACATCTAGTTAATCATAGGTTTGATATG
TAGTTACGTATTTTTTCTAATGTGCATTAAAACAAATCCATAATTATTAAAATAAATGTTGTTTGTGTG
CCACCTGAGGGCAGCTTGCATCCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_138322.4
Summary This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
Locus ID 5046
MW 22.1

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.