HLAB (HLA-B) (NM_005514) Human 3' UTR Clone

CAT#: SC205869

3' UTR clone of major histocompatibility complex class I B (HLA-B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-B
• Synonyms: AS; B-4901; HLAB
• ACCN: NM_005514
• Insert Size: 456 bp
• Sequence Data:
  Insert Sequence

  >SC205869 3’UTR clone of NM_005514
  The sequence shown below is from the reference sequence of NM_005514. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  CAGGGCTCTGATGTGTCTCTCACAGCTTGAAAAGCCTGAGACAGCTGTCTTGTGAGGGACTGAGATGCA
  GGATTTCTTCACGCCTCCCCTTTGTGACTTCAAGAGCCTCTGGCATCTCTTTCTGCAAAGGCACCTGAA
  TGTGTCTGCGTCCCTGTTAGCATAATGTGAGGAGGTGGAGAGACAGCCCACCCTTGTGTCCACTGTGAC
  CCCTGTTCCCATGCTGACCTGTGTTTCCTCCCCAGTCATCTTTCTTGTTCCAGAGAGGTGGGGCTGGAT
  GTCTCCATCTCTGTCTCAACTTTACGTGCACTGAGCTGCAACTTCTTACTTCCCTACTGAAAATAAGAA
  TCTGAATATAAATTTGTTTTCTCAAATATTTGCTATGAGAGGTTGATGGATTAATTAAATAAGTCAATT
  CCTGGAATTTGAGAGAGCAAATAAAGACCTGAGAACCTTCCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005514.8
• Summary: HLA-B belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exon 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Hundreds of HLA-B alleles have been described. [provided by RefSeq, Jul 2008]
• Locus ID: 3106
• MW: 16.5