ABCA4 (NM_000350) Human 3' UTR Clone

CAT#: SC205376

3' UTR clone of ATP-binding cassette sub-family A (ABC1) member 4 (ABCA4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCA4
• Synonyms: ABC10; ABCR; ARMD2; CORD3; FFM; RMP; RP19; STGD; STGD1
• ACCN: NM_000350
• Insert Size: 433 bp
• Sequence Data:
  Insert Sequence

  >SC205376 3’UTR clone of NM_000350
  The sequence shown below is from the reference sequence of NM_000350. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GCTGGAGCCAGTCGACAAGCCCAGGACTGATCTTTCACACCGCTCGTTCCTGCAGCCAGAAAGGAACTC
  TGGGCAGCTGGAGGCGCAGGAGCCTGTGCCCATATGGTCATCCAAATGGACTGGCCAGCGTAAATGACC
  CCACTGCAGCAGAAAACAAACACACGAGGAGCATGCAGCGAATTCAGAAAGAGGTCTTTCAGAAGGAAA
  CCGAAACTGACTTGCTCACCTGGAACACCTGATGGTGAAACCAAACAAATACAAAATCCTTCTCCAGAC
  CCCAGAACTAGAAACCCCGGGCCATCCCACTAGCAGCTTTGGCCTCCATATTGCTCTCATTTCAAGCAG
  ATCTGCTTTTCTGCATGTTTGTCTGTGTGTCTGCGTTGTGTGTGATTTTCATGGAAAAATAAAATGCAA
  ATGCACTCATCACAAACTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000350.3
• Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein is a retina-specific ABC transporter with N-retinylidene-PE as a substrate. It is expressed exclusively in retina photoreceptor cells, and the gene product mediates transport of an essental molecule, all-trans-retinal aldehyde (atRAL), across the photoreceptor cell membrane. Mutations in this gene are found in patients diagnosed with Stargardt disease, a form of juvenile-onset macular degeneration. Mutations in this gene are also associated with retinitis pigmentosa-19, cone-rod dystrophy type 3, early-onset severe retinal dystrophy, fundus flavimaculatus, and macular degeneration age-related 2. [provided by RefSeq, Sep 2019]
• Locus ID: 24
• MW: 16.1