HLA DMB (HLA-DMB) (NM_002118) Human 3' UTR Clone

CAT#: SC204424

3' UTR clone of major histocompatibility complex class II DM beta (HLA-DMB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-DMB
• Synonyms: D6S221E; RING7
• ACCN: NM_002118
• Insert Size: 365 bp
• Sequence Data:
  Insert Sequence

  >SC204424 3’UTR clone of NM_002118
  The sequence shown below is from the reference sequence of NM_002118. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  AATTATTCAGAAGGATGGCACATTTCCTAGAGGCAGAATCCTACAACTTCCACTCCAAGTGAGAAGGAG
  ATTCAAACTCAATGATGCTACCATGCCTCTCCAACATCTTCAACCCCCTGACATTATCTTGGATCCTAT
  GGTTTCTCCATCCAATTCTTTGAATTTCCCAGTCTCCCCTATGTAAAACTTAGCAACTTGGGGGACCTC
  ATTCCTGGGACTATGCTGTAACCAAATTATTGTCCAAGGCTATATTTCTGGGATGAATATAATCTGAGG
  AAGGGAGTTAAAGACCCTCCTGGGGCTCTCAGTGTGCCATAGAGGACAGCAACTGGTGATTGTTTCAGA
  GAAATAAACTTTGGTGGAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002118.5
• Summary: HLA-DMB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta (DMB) chain, both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP (class II-associated invariant chain peptide) molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
• Locus ID: 3109
• MW: 13.7