HLA DM (HLA-DMA) (NM_006120) Human 3' UTR Clone

CAT#: SC203075

3' UTR clone of major histocompatibility complex class II DM alpha (HLA-DMA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HLA-DMA
• Synonyms: D6S222E; DMA; HLADM; RING6
• ACCN: NM_006120
• Insert Size: 276 bp
• Sequence Data:
  Insert Sequence

  >SC203075 3’UTR clone of NM_006120
  The sequence shown below is from the reference sequence of NM_006120. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  TACTTCCGGAAGCCTTGCTCAGGTGACTGATTCTTCCAGACCAGAGTTTGATGCCAGCAGCTTCGGCCA
  TCCAAACAGAGGATGCTCAGATTTCTCACATCCTGCCCAGGATCTCCTCTTAGGGTAGAAGTCTCTGGG
  ACATCCCTGGGGTGTGTGTGTAGATTTCCCACCTGGGGACTCTGCTGTCCCTGGGCTTGCATCCCAGGG
  ATCCCAGAGTGGCCTGCCTATCACAACCACATCCCTTCCCCCCACAAGGCAATAAATCTCATTTCTTTA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006120.4
• Summary: HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
• Locus ID: 3108
• MW: 10.4