QRICH2 (NM_032134) Human 3' UTR Clone

CAT#: SC202890

3' UTR clone of glutamine rich 2 (QRICH2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: QRICH2
• Synonyms: SPGF35
• ACCN: NM_032134
• Insert Size: 217 bp
• Sequence Data:
  Insert Sequence

  >SC202890 3’UTR clone of NM_032134
  The sequence shown below is from the reference sequence of NM_032134. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  ATTTCGGCTGGCAACACCTCAGAAAGATAGACCTTCCTCCGAGGGCCGTCTCTCCCAGCCGAACACAGC
  CCACCCGCCCAGCTCCGCCGCGGTGGCAAACAGGGGGCTGGAGAGGCACGTGGACATGCCTCCTGGGGA
  GGGGCTCGAGGAGCCCACGCGGGGGCCGCGGTCCAGCACCGCTCAGTGAGCGGAGGTGTAAATAAACAT
  TCAGGAGGAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_032134.3
• Summary: Has an essential role in the formation of sperm flagella and flagellar structure maintainance. It acts as a suppressor of ubiquitination and degradation of proteins involved in flagellar development and motility.[UniProtKB/Swiss-Prot Function]
• Locus ID: 84074
• MW: 7.2