YY1AP1 (NM_139118) Human 3' UTR Clone

CAT#: SC202287

3' UTR clone of YY1 associated protein 1 (YY1AP1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: YY1AP1
• Synonyms: GRNG; HCCA1; HCCA2; YY1AP
• ACCN: NM_139118
• Insert Size: 233 bp
• Sequence Data:
  Insert Sequence

  >SC202287 3’UTR clone of NM_139118
  The sequence shown below is from the reference sequence of NM_139118. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GCTACAGAGGAAATCAGTGGATTTCTTTGAGCTAGGAGAATAAGAGTCTGGAGACTGGGAGCCTTCACT
  TCGGCCTCCGATTGGTGGCGCATAGGGTGTAACCAATAGGAAACCCCTAAAGGGTACTTAAACCCCAGA
  TTTTGCAACTGGGGCTCTTGAGCAGCTTGCTTTAGCCTGCTCCCACTCTGTGGAATATACTTTTGCTTC
  AATAAATCTGTGCTTTTATTGCTTCA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_139118.3
• Summary: The encoded gene product presumably interacts with YY1 protein; however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 55249
• MW: 8.8