67kDa Laminin Receptor (RPSA) (NM_001012321) Human 3' UTR Clone

CAT#: SC201937

3' UTR clone of ribosomal protein SA (RPSA) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPSA
• Synonyms: 37LRP; 67LR; ICAS; LAMBR; lamR; LAMR1; LBP; LBP/p40; LRP; LRP/LR; NEM/1CHD4; p40; SA
• ACCN: NM_001012321
• Insert Size: 197 bp
• Sequence Data:
  Insert Sequence

  >SC201937 3' UTR clone of NM_001012321
  The sequence shown below is from the reference sequence of NM_001012321. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTAGGAGCAACCACTGACTGGTCTTAAGCTGTTCTTGCATAGGCTCTTAAGCAGCATGGAAAAATGGTTG
  ATGGAAAATAAACATCAGTTTCTAAAAGTTGTCTTCATTTAGTTTGCTTTTTACTCCAGATCAGAATACC
  TGGGATTGCATATCAAAGCATAATAATAAATACATGTCTCGACATGAGTTGTACTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001012321.1
• Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 3921