ABCA7 (NM_019112) Human 3' UTR Clone

CAT#: SC201606

3' UTR clone of ATP-binding cassette sub-family A (ABC1) member 7 (ABCA7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCA7
• Synonyms: ABCA-SSN; ABCX; AD9
• ACCN: NM_019112
• Insert Size: 177 bp
• Sequence Data:
  Insert Sequence

  >SC201606 3’UTR clone of NM_019112
  The sequence shown below is from the reference sequence of NM_019112. The complete sequence of this clone may contain minor differences, such as SNPs.
  Blue=Stop Codon Red=Cloning site
  
  GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
  TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
  GACCCTAGCACTGCCGAGACTGTGCTCTGAGCCTCCCTCCCCTGCGGGGCCGCGGGGAGGCCCTGGGAA
  TGGCAAGGGCAAGGTAGAGTGCCTAGGAGCCCTGGACTCAGGCTGGCAGAGGGGCTGGTGCCCTGGAGA
  AAATAAAGAGAAGGCTGGAGAGAAGCCGTGGTGGTGAAA
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
  CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
  
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_019112.4
• Summary: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This full transporter has been detected predominantly in myelo-lymphatic tissues with the highest expression in peripheral leukocytes, thymus, spleen, and bone marrow. The function of this protein is not yet known; however, the expression pattern suggests a role in lipid homeostasis in cells of the immune system. [provided by RefSeq, Jul 2008]
• Locus ID: 10347
• MW: 6.5