S100 Calcium Binding Protein A13 (S100A13) (NM_001024211) Human 3' UTR Clone

CAT#: SC201399

3' UTR clone of S100 calcium binding protein A13 (S100A13) transcript variant 3 for miRNA target validation


Reconstitution Protocol

USD 683.00

4 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

USD 188.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00

Other products for "S100A13"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol S100A13
ACCN NM_001024211
Insert Size 126 bp
Sequence Data
>SC201399 3’UTR clone of NM_001024211
The sequence shown below is from the reference sequence of NM_001024211. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAAGACCTGAAGATCAGGAAGAAGTAAAGCCGCCTGGCTGAGATGGGGTGGGCAGGGCAGAGCTGA
TCAGGGCCGAGCAGAACCGCACTCTTCCCAAATAAAGCTTCCTCCTTGAAACACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001024211.2
Summary The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein is widely expressed in various types of tissues with a high expression level in thyroid gland. In smooth muscle cells, this protein co-expresses with other family members in the nucleus and in stress fibers, suggesting diverse functions in signal transduction. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 6284
MW 4.7

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.