Whamm (NM_001004185) Mouse Recombinant Protein

CAT#: TP523421

Purified recombinant protein of Mouse WAS protein homolog associated with actin, golgi membranes and microtubules (Whamm), with C-terminal MYC/DDK tag, expressed in HEK293T cells, 20ug

Specifications

Product Data

• Species: Mouse
• Expression Host: HEK293T
• Expression cDNA Clone or AA Sequence:
  Protein Sequence

  >MR223421 representing NM_001004185
  Red=Cloning site Blue=ORF Green=Tags(s)
  
  GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
  GCCGCGATCGCC
  
  
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
  ACAAGGATGACGACGATAAGGTTTAA
• Tag: C-MYC/DDK
• Predicted MW: 89.4 kDa
• Concentration: >0.05 µg/µL as determined by microplate BCA method
• Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining
• Buffer: 25 mM Tris-HCl, 100 mM glycine, pH 7.3, 10% glycerol
• Note: For testing in cell culture applications, please filter before use. Note that you may experience some loss of protein during the filtration process.
• Storage: Store at -80°C after receiving vials.
• Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles.

Reference Data

• RefSeq: NP_001004185
• Locus ID: 434204
• UniProt ID: Q571B6
• Cytogenetics: 7 D3
• Refseq Size: 3069
• Refseq ORF: 2379
• Synonyms: BB081391; mKIAA1971; Whdc1
• Summary: Acts as a nucleation-promoting factor (NPF) that stimulates Arp2/3-mediated actin polymerization both at the Golgi apparatus and along tubular membranes. Involved as a regulator of Golgi positioning and morphology. Its activity in membrane tubulation requires F-actin and interaction with microtubules. Proposed to use coordinated actin-nucleating and microtubule-binding activities of distinct WHAMM molecules to drive membrane tubule elongation; when MT-bound can recruit and remodel membrane vesicles but is prevented to activate the Arp2/3 complex. Required for RhoD-dependent actin reorganization such as in cell adhesion and cell migration (By similarity). Participates in vesicle transport between the reticulum endoplasmic and the Golgi complex.[UniProtKB/Swiss-Prot Function]