Whamm (NM_001004185) Mouse Recombinant Protein
CAT#: TP523421
Purified recombinant protein of Mouse WAS protein homolog associated with actin, golgi membranes and microtubules (Whamm), with C-terminal MYC/DDK tag, expressed in HEK293T cells, 20ug
Product Images
Frequently bought together (1)
Other products for "Whamm"
Specifications
Product Data | |
Species | Mouse |
Expression Host | HEK293T |
Expression cDNA Clone or AA Sequence |
>MR223421 representing NM_001004185
Red=Cloning site Blue=ORF Green=Tags(s) GACGTTGTATACGACTCCTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Tag | C-MYC/DDK |
Predicted MW | 89.4 kDa |
Concentration | >0.05 µg/µL as determined by microplate BCA method |
Purity | > 80% as determined by SDS-PAGE and Coomassie blue staining |
Buffer | 25 mM Tris-HCl, 100 mM glycine, pH 7.3, 10% glycerol |
Note | For testing in cell culture applications, please filter before use. Note that you may experience some loss of protein during the filtration process. |
Storage | Store at -80°C after receiving vials. |
Stability | Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. |
Reference Data | |
RefSeq | NP_001004185 |
Locus ID | 434204 |
UniProt ID | Q571B6 |
Cytogenetics | 7 D3 |
Refseq Size | 3069 |
Refseq ORF | 2379 |
Synonyms | BB081391; mKIAA1971; Whdc1 |
Summary | Acts as a nucleation-promoting factor (NPF) that stimulates Arp2/3-mediated actin polymerization both at the Golgi apparatus and along tubular membranes. Involved as a regulator of Golgi positioning and morphology. Its activity in membrane tubulation requires F-actin and interaction with microtubules. Proposed to use coordinated actin-nucleating and microtubule-binding activities of distinct WHAMM molecules to drive membrane tubule elongation; when MT-bound can recruit and remodel membrane vesicles but is prevented to activate the Arp2/3 complex. Required for RhoD-dependent actin reorganization such as in cell adhesion and cell migration (By similarity). Participates in vesicle transport between the reticulum endoplasmic and the Golgi complex.[UniProtKB/Swiss-Prot Function] |
Documents
FAQs |
SDS |
Resources
Recombinant Protein Resources |
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.