Slc3a2 Mouse qPCR Primer Pair (NM_008577)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
Slc3a2 (Myc-DDK-tagged) - Mouse solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 (Slc3a2), transcript variant 2
USD 491.00
Other products for "Slc3a2"
Specifications
Product Data | |
Gene ID | 17254 |
Forward Sequence | GAGCGTACTGAATCCCTAGTCAC |
Reverse Sequence | GCTGGTAGAGTCGGAGAAGATG |
Accession No | BC065173, NM_008577, NM_008577.1, NM_008577.2, NM_008577.3, NM_008577.4, BU054912 |
UniProt ID | P10852 |
Synonyms | 4F2; 4F2HC; AI314110; Cd98; Ly-10; Ly-m10; Ly10; Mdu1; Mgp-2hc; NACAE |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.