hnRNP A1 (HNRNPA1) Human qPCR Primer Pair (NM_031157)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
HNRNPA1 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein A1 (HNRNPA1), transcript variant 2
USD 457.00
Other products for "HNRNPA1"
Specifications
Product Data | |
Gene ID | 3178 |
Forward Sequence | GCCCTGTCAAAGCAAGAGATGG |
Reverse Sequence | CGACCACTGAAGTTTCCTCCAC |
Accession No | NM_031157, NM_031157.1, NM_031157.2, NM_031157.3, BC009600, BC009600.1, BC002355, BC004945, BC012158, BC020442, BC033714, BC035253, BC052296, BC070315, BC071945, BC073162, BC074502, BC078165, BC103707, BC104236, BC104237, BC121133, BQ277208, BU501222, BU541100, BX425482, NM_031157.4 |
UniProt ID | P09651 |
Synonyms | ALS19; ALS20; hnRNP-A1; hnRNP A1; HNRPA1; HNRPA1L3; IBMPFD3; UP 1 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.