Tau (MAPT) Human qPCR Primer Pair (NM_016835)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
MAPT (Myc-DDK-tagged)-Human microtubule-associated protein tau (MAPT), transcript variant 2
USD 457.00
Other products for "MAPT"
Specifications
Product Data | |
Gene ID | 4137 |
Forward Sequence | CCAGTCCAAGTGTGGCTCAAAG |
Reverse Sequence | GCCTAATGAGCCACACTTGGAG |
Accession No | NM_016835, NM_016835.1, NM_016835.2, NM_016835.3, NM_016835.4, BC114948, BC000558, BC032572, BC040444, BC061892, BC071830, BC094805, BC098281, BC099721, BC101936, BC114504, BI552187, BN000503, BT006772 |
UniProt ID | P10636 |
Synonyms | DDPAC; FTDP-17; MAPTL; MSTD; MTBT1; MTBT2; PPND; PPP1R103; TAU; tau-40 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.