PDE7B Human qPCR Primer Pair (NM_018945)

CAT#: HP213288

qSTAR qPCR primer pairs against Homo sapiens gene PDE7B

USD 95.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 27115
Forward Sequence CAGCCTGGTAACACTGTTGTGC
Reverse Sequence GTGATACGGGTTTTGGCTGTGG
Accession No AR141679, NM_018945, XM_005266931, XM_011535755, XM_017010741
Synonyms bA472E5.1; bA472E5.1
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents