POLR1H Human qPCR Primer Pair (NM_014596)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
ZNRD1 (Myc-DDK-tagged)-Human zinc ribbon domain containing 1 (ZNRD1), transcript variant a
USD 150.00
Other products for "POLR1H"
Specifications
Product Data | |
Gene ID | 30834 |
Forward Sequence | ATGCCTATGTCGGTGGAGGAAG |
Reverse Sequence | CTTCATCGGCTGAACGCATCTG |
Accession No | NM_014596, NM_014596.1, NM_014596.2, NM_014596.3, NM_014596.4, NM_014596.5, BC010898, BC010898.1, BC050608, BC050608.1, BC051741, BG503963, BM798114, BQ690150, NM_014596.6 |
UniProt ID | Q9P1U0 |
Synonyms | A12.2; HTEX-6; HTEX6; hZR14; Rpa12; tctex-6; TCTEX6; TEX6; ZNRD1; ZR14 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.