Peroxiredoxin 5 (PRDX5) Human qPCR Primer Pair (NM_012094)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
PRDX5 (Myc-DDK-tagged)-Human peroxiredoxin 5 (PRDX5), nuclear gene encoding mitochondrial protein, transcript variant 1
USD 300.00
Other products for "PRDX5"
Specifications
Product Data | |
Gene ID | 25824 |
Forward Sequence | TGATGCCTTTGTGACTGGCGAG |
Reverse Sequence | CCAAAGATGGACACCAGCGAATC |
Accession No | NM_012094, NM_012094.1, NM_012094.2, NM_012094.3, NM_012094.4, BC110983, BC110983.1, BC113723, BC113725, BC143849, BC171733, BU598032 |
UniProt ID | P30044 |
Synonyms | ACR1; AOEB166; B166; HEL-S-55; PLP; PMP20; PRDX6; prx-V; PRXV; SBBI10 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.